BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1260000 1 BBa_K1260000 AFB1 ScFv with a his-tag, a SH3 ligand and a signal peptide 2014-04-24T11:00:00Z 2015-05-08T01:09:45Z The part is constructed artificially. AFB1 ScFv with a his-tag, a SH3 ligand and a signal peptide. The signal peptide is at the beginning of the sequence. With the part, you can let your E.coli produce antibody to target the aflatoxin B1. false false _1618_ 0 19163 9 It's complicated true We have improved the codons of the coding sequence. false Zhengfeng Liu annotation2372754 1 ssDsbA range2372754 1 1 69 annotation2372757 1 6*his-tag range2372757 1 820 837 annotation2372760 1 stop range2372760 1 925 930 annotation2372755 1 AFB1-ScFv range2372755 1 88 819 annotation2372758 1 linker 2 range2372758 1 847 891 annotation2372753 1 start range2372753 1 1 3 annotation2372759 1 SH3 Ligand range2372759 1 891 924 annotation2372756 1 linker 1 range2372756 1 70 87 BBa_K206001 1 BBa_K206001 pBAD weak 2009-10-16T11:00:00Z 2015-05-08T01:11:23Z Site-directed mutagenesis on <partinfo>I13453</partinfo> with the following primers: Forward: TAATCTTATGGATAAAAAAGCTATGGCATAGC Reverse: GCGGATCCTACCTGACGCTTTTTATC Released HQ 2013 Weaker version of wild type pBAD (<partinfo>I13453</partinfo>). false false _307_ 0 4172 9 In stock true No special considerations false Amelia Hardjasa annotation2049257 1 AraI2 range2049257 1 61 78 annotation2049256 1 AraI1 range2049256 1 40 57 annotation2049255 1 promoter range2049255 1 1 131 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1260005 1 BBa_K1260005 pbad-ScFv (whole device) 2014-05-23T11:00:00Z 2015-05-08T01:09:45Z It is constructed by four basic parts: BBa_K206001 BBa_B0030 BBa_K1260000 BBa_B0015. It is a fully constructed device, made up of a L+arabinose weak promoter, a strong RBS, a ScFv coding sequence, and a double terminator. false false _1618_ 0 19163 9 It's complicated false The expression of this device is very high, for the cds have been improved. false Zhengfeng Liu component2378288 1 BBa_B0030 component2378298 1 BBa_K1260000 component2378305 1 BBa_B0015 component2378286 1 BBa_K206001 annotation2378286 1 BBa_K206001 range2378286 1 1 130 annotation2378288 1 BBa_B0030 range2378288 1 139 153 annotation2378305 1 BBa_B0015 range2378305 1 1098 1226 annotation2378298 1 BBa_K1260000 range2378298 1 160 1089 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1260000_sequence 1 atgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggccactagaggtagcggcagcggtagcactagagcacaggtgaaactgcaacagagcggaaccgaagttgttaaaccgggggcaagcgttaagctgagctgtaaggcaagcggttatatttttaccagctatgatattgattgggttcgtcagaccccggaacagggtctggaatggattggttggatttttccgggtgaaggtagcaccgaatataatgaaaaattcaaaggtcgtgcaaccctgagcgtagataaaagcagcagcaccgcatatatggaactgaccaggctgaccagcgaagatagcgcagtttatttttgtgcacgtggtgattattatcgtcgttattttgacctgtggggtcagggtaccaccgttaccgtttcctcaggtggaggcggttcaggcggaggtggctctggcggtggcggatcggatattgaactgacccagagcccggcaattatgagcgcaagcccgggtgaacgtgtcaccatgacctgtagcgcaagcagcagcattcgttatatttattggtatcagcagaaaccgggtagcagcccgcgtctgctgatttatgatacaagcaatgttgcaccgggtgttccttttcgttttagcggtagcggtagcggtaccagctatagcctgaccattaatcgtatggaagcagaagatgcagcaacctattattgtcaggaatggagcggttatccgtacacctttggtggtggtaccaaactggaactgaaacgtcatcatcatcatcatcacactagagctgaggccgccgcaaaagaagcagcagctaaggaagctgcggcgaagccccctccagcgctgccgccaaaacgtcgccggtaataa BBa_K206001_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcttttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1260005_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcttttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagattaaagaggagaaatactagatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggccactagaggtagcggcagcggtagcactagagcacaggtgaaactgcaacagagcggaaccgaagttgttaaaccgggggcaagcgttaagctgagctgtaaggcaagcggttatatttttaccagctatgatattgattgggttcgtcagaccccggaacagggtctggaatggattggttggatttttccgggtgaaggtagcaccgaatataatgaaaaattcaaaggtcgtgcaaccctgagcgtagataaaagcagcagcaccgcatatatggaactgaccaggctgaccagcgaagatagcgcagtttatttttgtgcacgtggtgattattatcgtcgttattttgacctgtggggtcagggtaccaccgttaccgtttcctcaggtggaggcggttcaggcggaggtggctctggcggtggcggatcggatattgaactgacccagagcccggcaattatgagcgcaagcccgggtgaacgtgtcaccatgacctgtagcgcaagcagcagcattcgttatatttattggtatcagcagaaaccgggtagcagcccgcgtctgctgatttatgatacaagcaatgttgcaccgggtgttccttttcgttttagcggtagcggtagcggtaccagctatagcctgaccattaatcgtatggaagcagaagatgcagcaacctattattgtcaggaatggagcggttatccgtacacctttggtggtggtaccaaactggaactgaaacgtcatcatcatcatcatcacactagagctgaggccgccgcaaaagaagcagcagctaaggaagctgcggcgaagccccctccagcgctgccgccaaaacgtcgccggtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z