BBa_K127000 1 BBa_K127000 constitutive GFP generator with J23102 and B0034 2008-10-29T12:00:00Z 2015-05-08T01:09:46Z This part consists of J23102, B0034 and E0240. This part steadily generates GFP. When you use optical tweezer, by putting this part into your plasmid, you can catch your engineered E coli in your eyes. true false _202_ 0 3668 9 Discontinued false Nothing false Sho Takamori component1996192 1 BBa_B0034 component1996190 1 BBa_J23102 annotation1996190 1 BBa_J23102 range1996190 1 1 35 annotation1996192 1 BBa_B0034 range1996192 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23102 1 BBa_J23102 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034_sequence 1 aaagaggagaaa BBa_K127000_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagaaagaggagaaa BBa_J23102_sequence 1 ttgacagctagctcagtcctaggtactgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z