BBa_K128000 1 FLAG FLAG affinity tag 2008-07-09T11:00:00Z 2015-05-08T01:09:46Z This sequence is easily recognized by many antibodies. This is the polypeptide protein FLAG tag. It is used in antibody binding assays if there is no antibody against the studied protein. It should be put at either the N terminus or the C terminus of the protein This part uses the modified Silver BioBrick prefix and suffix to allow for protein construction. false false _178_ 0 2822 9 In stock false Tags are almost always used in conjunction with another protein (the one being studied), so we used the modified Silver BioBrick prefix and suffix to make the construction of funcitonal fusion peptides possible true Sara Mouradian annotation1966459 1 Flag tag range1966459 1 1 25 BBa_K128000_sequence 1 agactacaaagacgacgacgacaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z