BBa_K128003 1 BBa_K128003 p1025 2008-07-10T11:00:00Z 2015-05-08T01:09:46Z This peptide is a 20 amino acid section of the native S.mutans surface protein that binds to the glycoproteins of the teeth. It is taken straight from the 1999 Nature paper by CG Kelly et al. which discovered the efficacy of this peptide in competitive inhibition of S.mutans. This sequence codes for a short peptide, found to competitively inhibit binding of S.mutans to the tooth surface (CG et al.; Nature Biotechnol. 1999). S.mutans takes in sugars and secretes lactic acid, causing dental cavities, so introduction of this peptide into the mouth prevents cavities. This part uses the modified Silver BioBrick prefix and suffix to allow for protein construction. false false _178_ 0 2822 9 It's complicated false We used the modified Silver BioBrick prefix and suffix to make the construction of funcitonal fusion peptides possible. false Sara Mouradian annotation1966601 1 p1025 range1966601 1 22 81 BBa_K128003_sequence 1 gaattcgcggccgcttctagacagctgaaaaccgctgacctgccggctggtcgtgacgaaaccacctctttcgttctggttactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z