BBa_K128004 1 secretion signal sequence from Lactobacillus bulgaricus; secretes protein 2008-07-17T11:00:00Z 2015-05-08T01:09:46Z It was isolated from the 5' end of the prtB gene in Lactobacillus bulgaricus, which codes for a lactose digesting protein that is bound to the surface (Germond JE et al.; Appl Environ Microbiol. 2003). This part uses the modified Silver BioBrick prefix and suffix to allow for protein construction. This is a short signal sequence recognized as a secretion tag by several Lactobacillus strains. As the protein that is attatched to is secreted, the signal peptide is cut off. Using [[http://www.cbs.dtu.dk/services/SignalP/|SignalP]], the cleavage site is between residues 39 and 40 (VQA - AS). This may change depending on the following sequence. This part uses the modified Silver BioBirck prefix and suffix to allow for protein construction. false false _178_ 0 2822 9 It's complicated false The cleavage site may be influenced by the protein that is attached to the signal peptide. To make sure that the protein does not get cleaved by mistake, four residues are added to the signal peptide sequence found by the Germond paper. Signal peptides are almost always used in conjunction with another protein so we used the modified Silver BioBrick prefix and suffix to make the construction of funcitonal fusion peptides possible true Sara Mouradian BBa_K128004_sequence 1 atgcagaagaaaaaatccgcacgccatttgaacaaagtggctgaattagccgcagcactgctcctatcagcgagtccactggcgggaactttccagtcagccgcttttgtccaagctgccagtcaagaaacgctccggttacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z