BBa_K128006 1 BBa_K128006 L.bulgaricus LacS Promoter 2008-10-24T11:00:00Z 2015-05-08T01:09:46Z Comes from the genomic DNA of Lactobacillus delbruckii subsp. bulgaricus. This is the native LacS Promoter of the bacteria Lactobacillus delbruckii subsp. bulgaricus. It is a LacS promoter taken from genomic DNA. It should include a ribosome binding site also, so no additional RBS is needed. This promoter should be used in experiments that aim to alter the gene function of L. bulgaricus. It is a LacS promoter so should be able to be regulated. false false _178_ 0 2825 9 It's complicated false Includes the LacS promoter and the ribosome binding site (RBS) false Derek Ju BBa_K128006_sequence 1 aagaggctatatcgccatcattagcagcttaattgaatatttactggctaaactattgagttttcaaggcttcatagttctttttggtgtgggaagtttaaattactaaaaatattttagtaaaacatcttggtttatttagtaaacaagtctatactgtaattataaacaagttaacacacctaaaggagaatttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z