BBa_K1283000 1 BBa_K1283000 The protective melittin generator 2014-06-12T11:00:00Z 2015-05-08T01:09:46Z From academic paper The protective melittin generator is composed of two transcriptional devices: RecA (SOS) promoter (BBa_J22106) and synthesized melittin gene with enterokinase digested sequence. The protective generator takes as input extensive UV radiation and produces as output fusion melittin. Melittin can improve immunity and scavenging free radicals to alleviate the harm from electromagnetic radiation, such as blue light and UV. false false _1646_ 0 15707 9 It's complicated false 5'-tcgcggccgcttctagag-3' 3'-aagtaatcttgccggactgc-5' false Hongmei Du annotation2379053 1 BBa_B0034 range2379053 1 201 212 annotation2379056 1 Melittin range2379056 1 255 332 annotation2379054 1 6-His range2379054 1 222 239 annotation2379052 1 BBa_J22106 range2379052 1 1 189 annotation2379055 1 Enterokinase digested sequence range2379055 1 240 254 BBa_K1283000_sequence 1 aacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagaacatattgactatccggtattacccggcatgacaggagtaaaaatggctatcgacgaaaacaaacagaaagcgttggcggcagcactgggccagattgagaaacaatttggtaaaggctccatcatgtaataatactagagaaagaggagaaatactagatgcatcatcaccatcaccatgacgacgacgacaagggaattggagcagttctgaaggtattaaccacaggattgcccgccctcataagttggattaaacgtaagaggcaacagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z