BBa_K1290000 1 BBa_K1290000 SpeB_Cleavage_Site 2014-06-19T11:00:00Z 2015-05-08T01:09:46Z Ender, Miriam, Federica Andreoni, Annelies Sophie Zinkernagel, and Reto Andreas Schuepbach. "Streptococcal SpeB Cleaved PAR-1 Suppresses ERK Phosphorylation and Blunts Thrombin-Induced Platelet Aggregation." (2013): n. pag. PLOS. Web. 12 June 2014. The aminoacid sequence which is cleaved by SpeB, birulence factor of S. Pyogenes. false false _1653_ 0 15185 9 Not in stock false We carefully checked the possible sequences. false Dilara Soylu BBa_K1290000_sequence 1 cgtagctttctgctgcgtaatccgaatgataaatatgaaccgttttgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z