BBa_K1290001 1 BBa_K1290001 OmpA-SpeB_Cleavage_Site 2014-06-19T11:00:00Z 2015-05-08T01:09:46Z S. Pyogenes's enzyme which is a cysteine proteinase functioning enzyme Construct is consisting of a cell wall protein, linker sequence and SpeB cleavage site is designed. The cell wall protein OmpA is preferred, due to its abundant usage. The linker segregates the OmpA and SpeB cleavage site and thus creating space for the SpeB to access the cleavage site; the sequence of the linker is taken from the Imperial College 2010 project. false false _1653_ 0 15187 9 Not in stock true This is the base part designed for S. Pyogenes detecting devices false Beril Gurdap BBa_K1290001_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctccgtagctttctgctgcgtaatccgaatgataaatatgaaccgttttgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z