BBa_J01008 1 Key 1 Riboregulator key 1 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Released HQ 2013 Biobricked version of Isaacs' riboregulator trans activating key, taR12 false true _13_ 0 395 13 In stock false false Golden Bear BBa_I714075 1 BBa_I714075 [J01008][B0015] ([Key1][Double Terminator]) 2007-10-21T11:00:00Z 2015-08-31T04:07:48Z [J01008] + [B0015] Released HQ 2013 This is J01008(key 1) with B0015 double terminator in the end. false false _142_ 0 2248 9 In stock false false Mingzhi Qu component1952129 1 BBa_J01008 component1952132 1 BBa_B0012 component1952130 1 BBa_B0010 annotation1952132 1 BBa_B0012 range1952132 1 191 231 annotation1952129 1 BBa_J01008 range1952129 1 1 94 annotation1952130 1 BBa_B0010 range1952130 1 103 182 BBa_K1300000 1 BBa_K1300000 recA promoter + Key (taRNA) 2014-06-15T11:00:00Z 2015-05-08T01:09:46Z Source parts were obtained from the iGEM Registry of Standard Biological Parts. RecA is a UV-light-inducible promoter. Trans is a "key" of sorts, acting on a complementary cis "lock" to allow the translation of ccdB, a kill gene. Together, the RecA+Trans system allows for the kill gene to be translated in the presence of UV light, through the indirect induction by way of the cis-trans system. false false _1663_ 0 19613 9 It's complicated false We had to consider whether the design was too complicated, whether it wouldn't be better to just have a more simple, direct system whereby a kill gene was translated because of the action of a UV-light-inducible promoter. In the end, we decided to make both systems, as the latter has been done before and submitted to the iGEM Registry of Standard Biological Parts. false StuyGem component2379199 1 BBa_J22106 component2379207 1 BBa_I714075 annotation2379199 1 BBa_J22106 range2379199 1 1 192 annotation2379207 1 BBa_I714075 range2379207 1 201 431 BBa_J22106 1 BBa_J22106 rec A (SOS) Promoter 2006-09-04T11:00:00Z 2015-08-31T04:08:38Z The recA(SOS)promoter gene from the chromosomal DNA isolated from MG1655 has been PCR amplified and inserted into plasmid pSB1A2(part number BBa_B0015). Rec A (SOS) promoter. false true _70_ 0 1038 70 In stock false NA true Krithiga Sankaran BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1300000_sequence 1 aacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagaacatattgactatccggtattacccggcatgacaggagtaaaaatggctatcgacgaaaacaaacagaaagcgttggcggcagcactgggccagattgagaaacaatttggtaaaggctccatcatgtaataatactagagacccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J22106_sequence 1 aacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagaacatattgactatccggtattacccggcatgacaggagtaaaaatggctatcgacgaaaacaaacagaaagcgttggcggcagcactgggccagattgagaaacaatttggtaaaggctccatcatgtaataa BBa_J01008_sequence 1 acccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_I714075_sequence 1 acccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z