BBa_J01010 1 Lock 1 Riboregulator Lock 1 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Biobricked version of Isaacs' riboregulator cis repressed lock, crR12. false false _13_ 0 395 13 In stock false false Golden Bear BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K414005 1 BBa_K414005 ccdB minimal gene 2010-10-13T11:00:00Z 2015-06-15T02:56:24Z The ccdB gene was obtained from the U-GENT vector pK7FWG2.0 The ccdB gene is a topoisomerase II poison and will kill most cell lines. This is an improvement to the prior ccdB cell death gene (BBa_P1010) in that the size has been reduced and it is now easier to use. CcdB can be used as a selectable marker by mixing it with the desired structure and a plasmid cut with BioBrick restriction enzymes. After ligation and transformation, because ccdB is toxic to most cell lines, the only visible colonies should contain the desired structure in the desired plasmid. CcdB is toxic to most cell lines with the exception of DB3.1 cell lines (BBa_V1005). true false _534_ 4206 7066 9 It's complicated true None false Randy Pares annotation2102408 1 Pt mutation G to A range2102408 1 103 103 annotation2086054 1 ccdB gene start codon range2086054 1 330 332 annotation2102420 1 Pt mutation A to G range2102420 1 321 321 annotation2086055 1 ccdB gene stop codon range2086055 1 632 634 annotation2086053 1 ccdB gene coding region range2086053 1 330 632 BBa_K1300001 1 BBa_K1300001 pTet promoter + Lock (crRNA) + ccdB + dterm 2014-06-15T11:00:00Z 2015-05-08T01:09:46Z The components for this part were obtained from the iGEM Registry of Standard Biological Parts. pTet is a constitutive promoter, meaning that the Cis+ccdB gene is continuously transcribed; however, because the Cis portion of the mRNA forms a hairpin which blocks the RBS, the gene cannot be translated. In this way, the Cis acts as a "lock" which will only allow translation, and therefore cell death, once opened. We designed a separate gene to act as a "key," controlled by a UV-light-inducible promoter (BBa_K1300000). false false _1663_ 0 19613 9 Not in stock false We took the pTet+Cis out of the Registry and added a toxin behind it in order to test the riboregulatory system, by means of a kill switch. false Katty Wu component2379220 1 BBa_K414005 component2379227 1 BBa_B0015 component2379214 1 BBa_J01060 annotation2379214 1 BBa_J01060 range2379214 1 1 102 annotation2379227 1 BBa_B0015 range2379227 1 779 907 annotation2379220 1 BBa_K414005 range2379220 1 111 770 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J01060 1 [pTET][loc OnLock1 = [pTet][Lock1] 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Released HQ 2013 [pTet][Lock1] false true _13_ 0 395 13 In stock false false Golden Bear component1738596 1 BBa_J01010 component1738591 1 BBa_R0040 annotation1738591 1 BBa_R0040 range1738591 1 1 54 annotation1738596 1 BBa_J01010 range1738596 1 63 102 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1300001_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaactagaatcacctcttggatttgggtattaaagaggagatactagagggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacaggggctggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagcctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J01060_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaactagaatcacctcttggatttgggtattaaagaggaga BBa_J01010_sequence 1 aactagaatcacctcttggatttgggtattaaagaggaga BBa_K414005_sequence 1 ggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacaggggctggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagcc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z