BBa_K1300002 1 BBa_K1300002 Constitutive T7 promoter + Lock (crRNA) 2014-06-15T11:00:00Z 2015-05-08T01:09:46Z We ordered oligos of T7+Cis from IDT and then ligated them into a vector. This is the Cis "key" for our riboregulator system with a T7 constitutive promoter. false false _1663_ 0 19613 9 Not in stock false We chose the T7 promoter because it didn't have any secondary structure, unlike pTet, and the whole point of the Cis "key" is to create a secondary structure. We ordered oligos so that the Cis wouldn't be able to fold up on itself when it was first created, so that we'd be able to ligate it into a vector. false Katty Wu, Ellen Jorgensen annotation2379228 1 T7 promoter range2379228 1 1 46 annotation2379229 1 cis repressed sequence range2379229 1 54 93 BBa_K1300002_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcacgtactaaactagaatcacctcttggatttgggtattaaagaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z