BBa_K1300003 1 BBa_K1300003 Constitutive T7 promoter + Lock (crRNA) + ccdB + dterm 2014-06-15T11:00:00Z 2015-05-08T01:09:46Z BBa_K1300002 was synthesized in oligo form; the other portion of the part was obtained from the iGEM Registry of Standard Biological Parts. We attached our T7+Cis "key" to a kill gene ccdB, in order to test our riboregulator system. false false _1663_ 0 19613 9 Not in stock false Our first attempt at ligating the T7+Cis portion of the part and the ccdB gene was unsuccessful; we are currently making another attempt. false StuyGem component2379241 1 BBa_K1300002 component2379243 1 BBa_K1300006 annotation2379243 1 BBa_K1300006 range2379243 1 100 405 annotation2379241 1 BBa_K1300002 range2379241 1 1 93 BBa_K1300006 1 BBa_K1300006 Coding ccdB (without RBS) 2014-06-15T11:00:00Z 2015-07-09T11:29:40Z We had this part synthesized by IDT. This is our kill gene ccdB with a ribosome binding site. true false _1663_ 4206 19613 9 In stock false The ccdB portion of the part was actually based off of an existing part in the Registry, which was out of stock. In order to isolate the ccdB gene (BBa_K1300005), we took this synthesized part and removed the RBS with primers. false Katty Wu annotation2379236 1 ccdB toxin range2379236 1 1 306 BBa_K1300002 1 BBa_K1300002 Constitutive T7 promoter + Lock (crRNA) 2014-06-15T11:00:00Z 2015-05-08T01:09:46Z We ordered oligos of T7+Cis from IDT and then ligated them into a vector. This is the Cis "key" for our riboregulator system with a T7 constitutive promoter. false false _1663_ 0 19613 9 Not in stock false We chose the T7 promoter because it didn't have any secondary structure, unlike pTet, and the whole point of the Cis "key" is to create a secondary structure. We ordered oligos so that the Cis wouldn't be able to fold up on itself when it was first created, so that we'd be able to ligate it into a vector. false Katty Wu, Ellen Jorgensen annotation2379228 1 T7 promoter range2379228 1 1 46 annotation2379229 1 cis repressed sequence range2379229 1 54 93 BBa_K1300002_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcacgtactaaactagaatcacctcttggatttgggtattaaagaggaga BBa_K1300003_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcacgtactaaactagaatcacctcttggatttgggtattaaagaggagatactagatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_K1300006_sequence 1 atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z