BBa_K1300005 1 BBa_K1300005 ccdB Translational Unit (with RBS) 2014-06-15T11:00:00Z 2015-07-09T11:30:26Z We had this part sequenced. ccdB is a kill gene that works by affecting topoisomerase II. true false _1663_ 4206 19613 9 Not in stock false This part is exactly the same as BBa_K414005, but the Registry part was out of stock. false StuyGem annotation2379238 1 ccdB toxin range2379238 1 15 320 annotation2379237 1 Shine-Dalgarno RBS range2379237 1 1 6 BBa_K1300005_sequence 1 aggaggtacagcacatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z