BBa_K1300006 1 BBa_K1300006 Coding ccdB (without RBS) 2014-06-15T11:00:00Z 2015-07-09T11:29:40Z We had this part synthesized by IDT. This is our kill gene ccdB with a ribosome binding site. true false _1663_ 4206 19613 9 In stock false The ccdB portion of the part was actually based off of an existing part in the Registry, which was out of stock. In order to isolate the ccdB gene (BBa_K1300005), we took this synthesized part and removed the RBS with primers. false Katty Wu annotation2379236 1 ccdB toxin range2379236 1 1 306 BBa_K1300006_sequence 1 atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z