BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2022 1 -10 range2022 1 38 43 annotation2024 1 OR1 range2024 1 25 41 annotation2023 1 -35 range2023 1 15 20 annotation2025 1 OR2 range2025 1 1 17 BBa_K1300010 1 BBa_K1300010 cI repressible promoter + translational ccdB 2014-06-18T11:00:00Z 2015-05-08T01:09:47Z Composite part. Our third system for comparing. false false _1663_ 0 19172 9 Not in stock false askldjf false Katty Wu component2379387 1 BBa_K1300005 component2379346 1 BBa_R0051 component2379378 1 BBa_K1300005 component2379352 1 BBa_R0051 component2379382 1 BBa_K1300005 component2379380 1 BBa_K1300005 component2379350 1 BBa_R0051 component2379348 1 BBa_R0051 component2379386 1 BBa_K1300005 component2379347 1 BBa_R0051 component2379349 1 BBa_R0051 component2379379 1 BBa_K1300005 annotation2379348 1 BBa_R0051 range2379348 1 1 49 annotation2379382 1 BBa_K1300005 range2379382 1 58 377 annotation2379350 1 BBa_R0051 range2379350 1 1 49 annotation2379386 1 BBa_K1300005 range2379386 1 58 377 annotation2379378 1 BBa_K1300005 range2379378 1 58 377 annotation2379346 1 BBa_R0051 range2379346 1 1 49 annotation2379387 1 BBa_K1300005 range2379387 1 58 377 annotation2379347 1 BBa_R0051 range2379347 1 1 49 annotation2379379 1 BBa_K1300005 range2379379 1 58 377 annotation2379352 1 BBa_R0051 range2379352 1 1 49 annotation2379349 1 BBa_R0051 range2379349 1 1 49 annotation2379380 1 BBa_K1300005 range2379380 1 58 377 BBa_K1300005 1 BBa_K1300005 ccdB Translational Unit (with RBS) 2014-06-15T11:00:00Z 2015-07-09T11:30:26Z We had this part sequenced. ccdB is a kill gene that works by affecting topoisomerase II. true false _1663_ 4206 19613 9 Not in stock false This part is exactly the same as BBa_K414005, but the Registry part was out of stock. false StuyGem annotation2379237 1 Shine-Dalgarno RBS range2379237 1 1 6 annotation2379238 1 ccdB toxin range2379238 1 15 320 BBa_K1300005_sequence 1 aggaggtacagcacatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_K1300010_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaggaggtacagcacatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z