BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J01008 1 Key 1 Riboregulator key 1 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Released HQ 2013 Biobricked version of Isaacs' riboregulator trans activating key, taR12 false true _13_ 0 395 13 In stock false false Golden Bear BBa_I714075 1 BBa_I714075 [J01008][B0015] ([Key1][Double Terminator]) 2007-10-21T11:00:00Z 2015-08-31T04:07:48Z [J01008] + [B0015] Released HQ 2013 This is J01008(key 1) with B0015 double terminator in the end. false false _142_ 0 2248 9 In stock false false Mingzhi Qu component1952132 1 BBa_B0012 component1952130 1 BBa_B0010 component1952129 1 BBa_J01008 annotation1952130 1 BBa_B0010 range1952130 1 103 182 annotation1952132 1 BBa_B0012 range1952132 1 191 231 annotation1952129 1 BBa_J01008 range1952129 1 1 94 BBa_K1300012 1 BBa_K1300012 UV promoter + Key (taRNA) 2014-06-18T11:00:00Z 2015-05-08T01:09:47Z Built from existing parts in the registry though BioBrick Assembly. This part did not work because we could not isolate the UV promoter. false false _1663_ 0 19172 9 Not in stock false None. false StuyGem component2379431 1 BBa_I714075 component2379423 1 BBa_I765001 annotation2379431 1 BBa_I714075 range2379431 1 85 315 annotation2379423 1 BBa_I765001 range2379423 1 1 76 BBa_I765001 1 pUV UV promoter 2007-10-25T11:00:00Z 2015-08-31T04:08:09Z Genomic sequence This device is regulated by UV irradiation false false _118_ 0 2266 9 In stock false None true iGEM Colombian Team 2007 annotation1955941 1 promoter range1955941 1 1 76 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J01008_sequence 1 acccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_I714075_sequence 1 acccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1300012_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtttactagagacccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I765001_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z