BBa_K130004 1 BBa_K130004 YcdO Export 2008-10-28T12:00:00Z 2015-05-08T01:09:47Z Oligonucleotides Export tag from YcdO gene (Sec export pathway). false false _249_ 0 2768 9 Not in stock false Constructed from overlapping oligonucleotides. false Basudeb Bhattacharyya BBa_K130004_sequence 1 atgaccatcaacttccgtcgcaatgcgctgcagctgtctgttgctgcactgttttccagcgccttcatggcgaatgcagctgacgtgccgcaggtaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z