BBa_K131001 1 BBa_K131001 ColE2 SOS Promoter 2008-07-21T11:00:00Z 2015-05-08T01:09:47Z This part comes from the ColE2 operon, which came from a plasmid. This promoter normally represses the ColE2 activity gene, ceaB, in the ColE2 operon. To activate this promoter would require a RecA positive strain, as the protein LexA represses the promoter. To induce this promoter, an intercalating agent, mitomycin C, was utilized to induce the SOS response, and thus the expression of the genes under control of this promoter. true false _259_ 0 1917 9 Discontinued false Lab strains of E. coli, such as Top10 from Invitrogen, are deficient in RecA so we required a RecA positive strain to induce this promoter. We used BL21 from Novagen. false Kevin McLeod annotation1968167 1 SOS Box range1968167 1 252 267 annotation1968164 1 -35 Signal range1968164 1 218 224 annotation1968166 1 Region of Dyad Symmetry range1968166 1 136 161 annotation1968165 1 -15 Signal range1968165 1 241 246 BBa_K131001_sequence 1 aactcggttttaatcagacctggcatgagtggaagcgggacgaacagcacaggcaacaacaacgccgccccgggcacttccggggcatgagtatgtgatatccggggctgcaccccggaccccgccaacacatcacgggccacaaaattttttgtggcccgctctgcgttttctaagtgttatccctcctgatttctaaaaaattttccacctgaacttgacagaaaaaacgatgacgggtactttttgatctgtacataaaaccag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z