BBa_K131005 1 CelB Colicin E2 Lysis Gene (CelB) 2008-07-22T11:00:00Z 2015-05-08T01:09:47Z Comes from the colicin E2 operon (part K131001). This is the lysis gene, that is activated upon expression of the colicin E2 operon. It causes partial lysis, activates phospholipase A, and facilitates the efflux of colicin (Cole ''et al.'', 1985). true false _259_ 0 1917 9 Discontinued false None. false Kevin McLeod BBa_K131005_sequence 1 atgaaaaaaataacagggattattttattgcttcttgcagtcattattctgtctgcatgtcaggcaaactatatccgggatgttcagggcgggaccgtatctccgtcatcaacagctgaagtgaccggattagcaacgcagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z