BBa_K1311001 1 BBa_K1311001 left arm->TALE02->right arm 2014-10-09T11:00:00Z 2015-05-08T01:09:47Z We chose the native TALE AvrBs3 as a scaffold for customized assembly of TALE constructs. This part is one of the product of the TALE assembly strategy. The TALE assembly strategy uses the Golden Gate cloning method, which is based on the ability of type IIS enzymes to cleave outside of their recognition site. When type IIS recognition sites are placed to the far 5??? and 3??? end of any DNA fragment in inverse orientation, they are removed in the cleavage process, allowing two DNA fragments flanked by compatible sequence overhangs, termed fusion sites, to be ligated seamlessly. Since type IIS fusion sites can be designed to have different sequences, directional assembly of multiple DNA fragments is feasible. Using this strategy, DNA fragments can be assembled from undigested input plasmids in a one-pot reaction with high efficiency. We chose the native TALE AvrBs3 as a scaffold for customized assembly of TALE constructs. The central DNA binding domain of AvrBs3 is formed by 17.5 tandemly arranged 34 amino acid repeats, with the last half repeat showing similarity to only the first 20 amino acids of a full repeat. In a single Golden Gate cloning reaction, cloning efficiency is significantly reduced for assembly of 17 repeat modules. Therefore, we split the assembly in two successive steps to obtain TALE01, TALE 02, etc. In the next cloning step, 11~17 repeats are assembled in one vector, during which we got TALE02. The preassembly vectors confer SpecR and encode a lacZ-α fragment for blue/white selection. On both sides of the lacZ-α fragment a type IIS recognition sequence - BsaI - is positioned. After preassembly of the 10 and 7 and last repeats using BsaI, the intermediate blocks are released via Esp3I and cloned into the final assembly vector (modified pTAL1). Modified pTAL1 confers AmpR, and allows plasmid replication in E.coli. The vector pTAL1 also contains all elements of the final TALE expression construct, except the repeat modules. Besides further assembly, TALE02 can also be used alone as a DNA binding protein to recognize and bind to the target sequence containing the 11~17 nucleotides. false false _1686_ 0 20376 9 It's complicated false Considering the further assembly, the left and right arm of TALE should not be ignored. false Yao Xiao annotation2414248 1 repeats11~17 range2414248 1 34 674 BBa_K1311001_sequence 1 cgtctcatggcctgaccccggaccaagtggtggctatcgccagcaacaatggcggcaagcaagcgctcgaaacggtgcagcggctgttgccggtgctgtgccaggaccatggcctgaccccggaccaagtggtggctatcgccagcaacattggcggcaagcaagcgctcgaaacggtgcagcggctgttgccggtgctgtgccaggaccatggcctgaccccggaccaagtggtggctatcgccagcaacattggcggcaagcaagcgctcgaaacggtgcagcggctgttgccggtgctgtgccaggaccatggcctgactccggaccaagtggtggctatcgccagccacgatggcggcaagcaagcgctcgaaacggtgcagcggctgttgccggtgctgtgccaggaccatggcctgaccccggaccaagtggtggctatcgccagcaacattggcggcaagcaagcgctcgaaacggtgcagcggctgttgccggtgctgtgccaggaccatggcctgaccccggaccaagtggtggctatcgccagcaacggtggcggcaagcaagcgctcgaaacggtgcagcggctgttgccggtgctgtgccaggaccatggcctgaccccggaccaagtggtggctatcgccagcaacaatggcggcaagcaagcgctcgaaacggtgcagcggctgttgccggtgctgtgccaggaccatggcctgaccccggaccaagtggtggctatcgagacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z