BBa_K1314000 1 BBa_K1314000 Ammonium repressible nifH promoter(from Azotobacter vinelandii) 2014-10-05T11:00:00Z 2015-05-08T01:09:47Z A. vinelandii(strain DJ) This part arose from the natural version of the A. vinelandii nifH promoter with illegal restriction site removed. It is part of the transcriptional regulatory system of the nitrogenase of A. vinelandii. The expression level of the gene under this promoter was found to be highest when nitrogen is depleted in A. vinelandii.(Trinity L. et al. , 2011) With a sufficiently low nitrogen level, the expression level from nifH promoter protein expression system is expected to be higher than that in tranditional E. coli T7 protein expression system. (2) false false _1689_ 0 19949 9 It's complicated false none false Seak Chi U, Chan Wai Lun, CHIU, Yee Ting annotation2396224 1 nifH promoter range2396224 1 1 220 BBa_K1314000_sequence 1 tgtcagttttgtcacagggggccggaccaggatggtggacgctcgatggggatgtcgggccattgttcggttgtagcaattacaacagtcggagtagggggattgtagggggattgttgtgtatcagaccgccctgctgctcccgtcgatggataattaatcatttaaaatcaatggtttatttatgtgttgcgggtgctggcacagacgctgcattacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z