BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_K1314010 1 BBa_K1314010 random sequence+T7 promoter 2014-10-06T11:00:00Z 2015-05-08T01:09:48Z - random sequence+T7 promoter false false _1689_ 0 19949 9 It's complicated false - false Seak Chi U, Chan Wai Lun, CHIU, Yee Ting component2397818 1 BBa_K1314002 component2397819 1 BBa_I712074 annotation2397818 1 BBa_K1314002 range2397818 1 1 150 annotation2397819 1 BBa_I712074 range2397819 1 159 204 BBa_K1314002 1 BBa_K1314002 150bp random sequence (spacer) 2014-10-05T11:00:00Z 2015-05-08T01:09:48Z synthesis by overlapping pcr A random sequence for stable integration of azotobacter vinelandii. false false _1689_ 0 20058 9 In stock false synthesis false Seak Chi U, Chan Wai Lun, CHIU, Yee Ting annotation2397292 1 random sequence/spacer range2397292 1 1 150 BBa_K1314002_sequence 1 ggaattggggcccttgtggcctaaatccaaccgcggatcagtcagggcgcggatcccctgcaacgtcgcgacgctagagatactctatccagcggtagctcgtgtggttcaaagggtaagccgtcacgctggcttcggaggtctatctgc BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_K1314010_sequence 1 ggaattggggcccttgtggcctaaatccaaccgcggatcagtcagggcgcggatcccctgcaacgtcgcgacgctagagatactctatccagcggtagctcgtgtggttcaaagggtaagccgtcacgctggcttcggaggtctatctgctactagagtaatacgactcactatagggaatacaagctacttgttctttttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z