BBa_K1315001 1 BBa_K1315001 The <i>pqsA</i> promoter from <i>Pseudomonas</i> 2014-09-19T11:00:00Z 2015-05-08T01:09:48Z The source of this part is the genome of Pseudomonas aeruginosa PAO1 provided by the Robert Ryan lab in the Molecular Microbiology department of the University of Dundee, UK. The Pseudomonas quinolone signal (PQS) is imperative in modulating mechanisms that enable Pseudomonas aeruginosa to survive at times of stress. P. aeruginosa is the main pathogen responsible for severe deterioration in the Cystic Fibrosis lungs. The production of this signal relies on the pqsABCDE operon. The transcriptional factor PqsR (BBa_K1315000) positively regulates this operon. http://www.ncbi.nlm.nih.gov/pubmed/25225275 http://www.ncbi.nlm.nih.gov/pubmed/16735731 http://www.ncbi.nlm.nih.gov/pubmed/21539583 http://www.ncbi.nlm.nih.gov/pubmed/?term=pqsr-dependent+and+pqsr-independent+regulation+of+motility+and+biofilm+formation+by+pqs http://www.ncbi.nlm.nih.gov/pubmed/12393198 false false _1690_ 0 21812 9 In stock false The sequence did not have any restriction sites to remove so it was immediately PCRed out of the genome and had the registry prefix and suffix added to it. It was then ligated into the pSB1C3 vector. false Dimitrios Michailidis annotation2384758 1 pqsABCDE range2384758 1 1 92 BBa_K1315001_sequence 1 gcctacgaagcccgtggttcttctccccgaaactttttcgttcggactccgaatatcgcgcttcgcccagcgccgctagtttcccgttcctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z