BBa_K1315005 1 BBa_K1315005 The <i>clp</i> gene from <i>Xanthomonas campestris</i> 2014-09-24T11:00:00Z 2015-05-08T01:09:50Z The source of this part is Xanthomonas campestris pv. campestris 8004 genomic DNA which was provided by the Robert Ryan lab in the Molecular Microbiology department of the University of Dundee, UK. c-di-GMP Repressed DNA Binding Protein (Clp) Quorum sensing and bacterial cell signalling are mechanisms known to be utilised by bacteria to regulate their virulence. The RpfC-RpfG sensory system has been found to activate the production of virulence factors like extracellular enzymes and polysaccharides in Xanthomonas campestris. It has been also suggested that this system is involved in linking environmental stimuli, including DSF, with pathogenicity in Xanthomonas campestris. DSF is a cis-unsaturated fatty acid from the DSF family. The RpfC-RpfG two-component system is the most well understood one and is present in all Xanthomonads. http://www.ncbi.nlm.nih.gov/pubmed/?term=r+ryan+dsf+family http://www.ncbi.nlm.nih.gov/pubmed/?term=A+two-component+system+involving+an+HD-GYP+domain+protein+links+cell%E2%80%93cell+signalling+to+pathogenicity+gene+expression+in+Xanthomonas+campestris false false _1690_ 0 21812 9 In stock false The sequence had 1 PstI site that was mutated out by site-directed mutagenesis. false Dimitrios Michailidis annotation2386527 1 Clp range2386527 1 1 696 BBa_K1315005_sequence 1 atgagcctagggaacacgacggttgtgactacgacggtacgtaacgctaccccctcactgacgctggacgcgggcaccattgagcgattcctggcgcacagccaccgcaggcgctatccgacccggaccgatgtgttccggccgggagaccccgctggcaccctctactacgtgatcagcggctcggtgagcatcattgccgaggaagatgacgatcgtgagttggtgctgggctacttcggtagcggcgagttcgttggtgagatggggttgttcatcgaatccgatacgcgcgaagtgatcctgcgcacccgcacgcaatgcgagttggctgaaatcagctacgagcgcctacagcagctgtttcagacgagtttgtcgccggatgcgccgcgaatcctgtacgccattggcgttcagctttcaaaacgcctgctcgataccacaaggaaagccagccgcctggcgttcctggatgtgaccgatcgcatcgtgcgcacgctgcacgatctgtcgaaggagccggaggcgatgagccatccgcagggtacgcagttgcgcgtctcgcggcaggaactcgcgcgcctggtcggctgctcgcgcgaaatggccggacgcgtcctgaagaaattgcaggccgatggcctgttgcatgcacgcggcaagaccgtcgtgttgtacggcacgcgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z