BBa_K1315006 1 BBa_K1315006 The <i>manA</i> promoter from <i>Xanthomonas campestris</i> 2014-09-25T11:00:00Z 2015-05-08T01:09:50Z The source of this part is Xanthomonas campestris pv. campestris 8004 genomic DNA which was provided by the Robert Ryan lab in the Molecular Microbiology department of the University of Dundee, UK. This is the promoter manA from Xcc. false false _1690_ 0 21812 9 In stock false The sequence did not have any restriction sites to remove so it was immediately PCRed out of the genome and had the registry prefix and suffix added to it. It was then ligated into the pSB1C3 vector. false Dimitrios Michailidis annotation2386904 1 manA range2386904 1 1 250 BBa_K1315006_sequence 1 cgctgtgcctacagggccgaggggttgctcgccgtttgcaacgagcgcgtggcgcccggacacgcacgagataacgttaccagcacgctggatgcggatctgcgcgctctgtcctgatctgtacctgttgtcggttctgtgacccgcgctgcgatcgcctgcgtcgcgggttggcacggtcttggcgcacgcccgatgcgcgctgtccgcggacgccggtctgcggcgtccaccttgtctggagccgagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z