BBa_K1316002 1 BBa_K1316002 yqjF promoter 2014-08-23T11:00:00Z 2015-05-08T01:09:50Z Belkin laboratory (Belkin et al. Appl Microbiol Biotechnol (2014) 98:885???895) Promoter of the yqjF gene, which is activated by the presence of several nitrogen-based compounds such as 2,4,6-TNT, 2,4-DNT and 1,3-DNB. false false _1691_ 0 19967 9 Not in stock false The sequence was positively checked for the absence of illegal restriction sites. It is, therefore, biobrick-compatible false Joan Cortada Garcia annotation2381283 1 yqjF promoter range2381283 1 1 249 BBa_K1316002_sequence 1 ggtggtacccggttttggcgtatggagcgcctggcatctggttaaaacgaccctcaagcagcaacagcttcgcggttaacttccctctggccggagccattccggccttatccctcaaattttttgaagatctttgacaattttccttgctaacaatcatcattcaccacgtttatgattctctccatcgacagcaacgacgctaataccgcgcctttgcacaaaaaaacaatcagcagcctgagtggccgagcatgctagacatatgcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z