BBa_K1316013 1 BBa_K1316013 pRhamnose regulating csgB + J23110 constitutive Anderson promoter regulating csgA 2014-09-28T11:00:00Z 2015-05-08T01:09:50Z csgA and csgB were PCRed out of the K540000 Lyon 2011 iGEM part. This part is meant to constitutively express the curli gene csgB which codes for the production of the curli protein that is anchored to the cell membrane (CsgB). The csgA gene codes for the major curli protein (CsgA), which forms long fibrils with other CsgA monomers in a self-assembly process. These CsgA long fibrils bind to the anchored CsgB protein forming the amyloid-like curli structure. As many more CsgA than CsgB subunits are required for curli formation, this part intends to have an already high amount of CsgA present in the cell (constitutively expressed) and, once the cell is induced (with Rhamnose in this case), only CsgB protein is required to be expressed for curli formation, thus leading to a faster curli generation process. false false _1691_ 0 19967 9 It's complicated true Many more CsgA protein subunits are required compared to CsgB in curli formation. false Joan Cortada Garcia component2423464 1 BBa_K1316019 component2423458 1 BBa_K1316018 annotation2423458 1 BBa_K1316018 range2423458 1 1 535 annotation2423464 1 BBa_K1316019 range2423464 1 544 1040 BBa_K1316019 1 BBa_K1316019 2nd part of Constitutive Anderson promoter + csgA curli gene 2014-10-15T11:00:00Z 2015-05-08T01:09:50Z The CDS of csgA contained in this part was PCRed from the iGEM BioBrick BBa_K540000 Lyon team 2011. Curli are extracellular amyloids that form fibers. They are involved in adhesion, cell aggregation and biofilm formation. CsgA is the major curli subunit. false false _1691_ 0 19967 9 Not in stock false The part was PCRed in a way that it contains the ending of a constitutive promoter right before the open reading frame (ORF) of csgA gene. This aims at constructing via Golden Gate Assembly the final BioBricks BBa_K1316013 and BBa_K1316014 where csgB and csgA genes are present and a constitutive promoter was placed between them. false Joan Cortada Garcia annotation2422004 1 csgA range2422004 1 27 479 annotation2423411 1 start range2423411 1 27 29 annotation2422002 1 Ending constit Promoter range2422002 1 1 13 annotation2422003 1 rbs range2422003 1 14 25 annotation2423410 1 stop range2423410 1 477 479 BBa_K1316018 1 BBa_K1316018 RBS + csgB curli-forming gene 2014-10-15T11:00:00Z 2015-05-08T01:09:50Z It comes from the iGEM BioBrick BBa_K914003 This part is a tightly regulated promoter that allows for high gene expression under the presence of L-rhamnose. At the same time, it shows good repression levels when L-rhamnose is not present, as well as with the presence of D-glucose. For more information read the description of part BBa_K914003, where we obtained the promoter from. false false _1691_ 0 19967 9 Not in stock false The sequence was screened for illegal iGEM restriction sites false Joan Cortada Garcia annotation2422000 1 csgB range2422000 1 44 499 annotation2422001 1 Beginning of J23110 constitutive Anderson promoter range2422001 1 509 531 annotation2421993 1 rbs range2421993 1 29 42 BBa_K1316019_sequence 1 gtacaatgctagcaaagaggagaaaacatgaaacttttaaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaactactagaaggagg BBa_K1316018_sequence 1 catatgtatacttcagcaaggaaatactagaaggaggtatataatgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaagtcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggcaaagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataaagcaaatattacacagtatggtactcaaaaaacggcaattgtagtgcagagacagtcgcaaatggctattcgcgtgacacaacgttaatttccattcgtttacggctagctcagtcctaggtac BBa_K1316013_sequence 1 catatgtatacttcagcaaggaaatactagaaggaggtatataatgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaagtcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggcaaagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataaagcaaatattacacagtatggtactcaaaaaacggcaattgtagtgcagagacagtcgcaaatggctattcgcgtgacacaacgttaatttccattcgtttacggctagctcagtcctaggtactactagaggtacaatgctagcaaagaggagaaaacatgaaacttttaaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtactaactactagaaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z