BBa_K1316018 1 BBa_K1316018 RBS + csgB curli-forming gene 2014-10-15T11:00:00Z 2015-05-08T01:09:50Z It comes from the iGEM BioBrick BBa_K914003 This part is a tightly regulated promoter that allows for high gene expression under the presence of L-rhamnose. At the same time, it shows good repression levels when L-rhamnose is not present, as well as with the presence of D-glucose. For more information read the description of part BBa_K914003, where we obtained the promoter from. false false _1691_ 0 19967 9 Not in stock false The sequence was screened for illegal iGEM restriction sites false Joan Cortada Garcia annotation2421993 1 rbs range2421993 1 29 42 annotation2422000 1 csgB range2422000 1 44 499 annotation2422001 1 Beginning of J23110 constitutive Anderson promoter range2422001 1 509 531 BBa_K1316018_sequence 1 catatgtatacttcagcaaggaaatactagaaggaggtatataatgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcagcaggttatgatttagctaattcagaatataacttcgcggtaaatgaattgagtaagtcttcatttaatcaggcagccataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttggcggttgttgcgcaagaaggtagtagcaaccgggcaaagattgaccagacaggagattataaccttgcatatattgatcaggcgggcagtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataaagcaaatattacacagtatggtactcaaaaaacggcaattgtagtgcagagacagtcgcaaatggctattcgcgtgacacaacgttaatttccattcgtttacggctagctcagtcctaggtac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z