BBa_K1316020 1 BBa_K1316020 2nd part of Constitutive Anderson promoter + csgA:Histag curli gene 2014-10-16T11:00:00Z 2015-05-08T01:09:50Z The CDS of csgA contained in this part was PCRed from the iGEM BioBrick BBa_K540000 Lyon team 2011. Curli are extracellular amyloids that form fibers. They are involved in adhesion, cell aggregation and biofilm formation. CsgA is the major curli subunit. A His tag was added at the C-terminus of csgA's coding sequence. This His has two functions: on one hand it allows easy purification of the CsgA protein; on the other hand, it enables the formation of conductive curli by adding gold nanoparticles (AuNP) with Nickel-Nitrilotriacetic-acid (NTA-Ni) attached to them. This last part containing Nickel would bind to the Histidines of the curli fibril, whereas the gold attached to it will make the environment more conductive. false false _1691_ 0 19967 9 Not in stock false The part was PCRed in a way that it contains the ending of a constitutive promoter right before the open reading frame (ORF) of csgA gene. This aims at constructing via Golden Gate Assembly the final BioBricks BBa_K1316013 and BBa_K1316014 where csgB and csgA genes are present and a constitutive promoter was placed between them. A His tag was added at the C-terminus of csgA's ORF. false Joan Cortada Garcia annotation2423204 1 rbs range2423204 1 14 25 annotation2423220 1 csgA range2423220 1 27 501 annotation2423405 1 stop range2423405 1 499 501 annotation2423368 1 His Tag range2423368 1 480 498 annotation2423202 1 Ending constit Promoter range2423202 1 1 13 annotation2423409 1 start range2423409 1 27 29 BBa_K1316020_sequence 1 gtacaatgctagcaaagaggagaaaacatgaaacttttaaaagtagcagcaattgcagcaatcgtattctccggtagcgctctggcaggtgttgttcctcagtacggcggcggcggtaaccacggtggtggcggtaataatagcggcccaaattctgagctgaacatttaccagtacggtggcggtaactctgcacttgctctgcaaactgatgcccgtaactctgacttgactattacccagcatggcggcggtaatggtgcagatgttggtcagggctcagatgacagctcaatcgatctgacccaacgtggcttcggtaacagcgctactcttgatcagtggaacggcaaaaattctgaaatgacggttaaacagttcggtggtggcaacggtgcagcagttgaccagactgcatctaactcctccgtcaacgtgactcaggttggctttggtaacaacgcgaccgctcatcagtaccatcatcaccatcaccactaactactagaaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z