BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_G0002 1 SX scar SpeI/XbaI mixed site 2007-02-26T12:00:00Z 2015-08-31T04:07:27Z XbaI and SpeI sites XbaI/SpeI mixed site. Simply used to aid in entry of parts into the registry. false true _41_ 0 126 70 Not in stock false None. false Reshma Shetty BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1319107 1 Scar25 TAA RFC 25 Translation Stop Scar Sequence 2014-10-02T11:00:00Z 2015-05-08T01:09:51Z This sequence is produced by an assembly method. This sequence is produced by RFC10-assembly of a RFC25-CDS with a RFC10-prefixed part. false false _1694_ 0 19522 9 Not in stock false The resulting sequence is a combination of 9 nucleotides from the RFC25 prefix (acc ggt taa) and the RFC10 scar (tactagag). false Michael Osthege annotation2393318 1 stop range2393318 1 7 9 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_K1319008 1 BBa_K1319008 IPTG-induced and T7-driven expression of TEV protease 2014-10-02T11:00:00Z 2015-05-08T01:09:50Z The part is combined from other BioBricks and a codon-optimized TEV protease CDS (K1319004). This protein generator produces TEV protease when induced with IPTG in a DE3 strain. false false _1694_ 0 19522 9 In stock true We created K1319004 in RFC[25] to enable potential false Michael Osthege, Florian Gohr component2393336 1 BBa_B0015 component2393319 1 BBa_I719005 component2393329 1 BBa_K1319107 component2393324 1 BBa_K1319106 component2393327 1 BBa_K1319004 component2393322 1 BBa_B0034 component2393320 1 BBa_G0002 annotation2393329 1 BBa_K1319107 range2393329 1 785 801 annotation2393322 1 BBa_B0034 range2393322 1 32 43 annotation2393320 1 BBa_G0002 range2393320 1 24 31 annotation2393327 1 BBa_K1319004 range2393327 1 59 784 annotation2393324 1 BBa_K1319106 range2393324 1 44 58 annotation2393319 1 BBa_I719005 range2393319 1 1 23 annotation2393336 1 BBa_B0015 range2393336 1 802 930 BBa_K1319106 1 Scar25 ATG RFC 25 Translation Start Scar Sequence 2014-10-02T11:00:00Z 2015-05-08T01:09:51Z This sequence is produced by an assembly method. This sequence is produced by RFC10-assembly of a RFC10-RBS with a RFC25-prefixed part. false false _1694_ 0 19522 9 Not in stock false The resulting sequence is a combination of the RFC10 RBS-CDS scar (tactag) and 9 nucleotides from the RFC25 prefix (atg gcc ggc). false Michael Osthege annotation2393317 1 start range2393317 1 7 9 BBa_K1319004 1 BBa_K1319004 TEV protease with anti-self cleavage mutation S219V, codon optimized for E. coli 2014-09-24T11:00:00Z 2015-05-08T01:09:50Z The part was codon optimized using the genomic amino acid sequence, designed for RFC25 and mutated S219V for anti-self cleavage properties. This part is a TEV protease in RFC25 that was optimized for expression in E. coli. The part contains the S219V anti-self cleavage mutation. false false _1694_ 0 19522 9 In stock false The part does not contain start or stop codons, because it was designed for RFC25 compability false Florian Gohr, Michael Osthege annotation2386540 1 S219V range2386540 1 655 657 annotation2386539 1 TEV protease range2386539 1 1 726 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_K1319107_sequence 1 accggttaatactagag BBa_B0034_sequence 1 aaagaggagaaa BBa_K1319008_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatggccggcggcgaaagcctgttcaaaggtccgcgtgactacaacccgattagctcgacgatctgccacctgacgaacgaaagcgacggccacaccacgagcctgtatggcatcggttttggcccgttcattatcacgaacaaacacctgtttcgtcgcaacaatggtaccctgctggtgcagtctctgcatggcgtgtttaaagttaaaaataccacgaccctgcaacaacacctgatcgatggtcgtgacatgattatcattcgcatgccgaaagattttccgccgttcccgcagaaactgaaattccgtgaaccgcaacgtgaagaacgcatttgcctggtcacgaccaactttcagaccaaatcaatgagctctatggttagcgatacgtcttgtacctttccgagttccgacggcatcttctggaaacattggattcagaccaaagatggtcaatgcggcagtccgctggtttccacccgtgacggtttcatcgtcggcattcactcagcgtcgaactttacgaataccaacaattacttcacgtccgttccgaaaaactttatggaactgctgaccaatcaggaagcgcagcaatgggtgtcaggttggcgcctgaatgccgattcggttctgtggggcggtcacaaagtctttatggtgaaaccggaagaaccgttccagccggtcaaagaagcaacccaactgatgaatgaactggtctactcccaaaccggttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1319106_sequence 1 tactagatggccggc BBa_G0002_sequence 1 tactagag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1319004_sequence 1 ggcgaaagcctgttcaaaggtccgcgtgactacaacccgattagctcgacgatctgccacctgacgaacgaaagcgacggccacaccacgagcctgtatggcatcggttttggcccgttcattatcacgaacaaacacctgtttcgtcgcaacaatggtaccctgctggtgcagtctctgcatggcgtgtttaaagttaaaaataccacgaccctgcaacaacacctgatcgatggtcgtgacatgattatcattcgcatgccgaaagattttccgccgttcccgcagaaactgaaattccgtgaaccgcaacgtgaagaacgcatttgcctggtcacgaccaactttcagaccaaatcaatgagctctatggttagcgatacgtcttgtacctttccgagttccgacggcatcttctggaaacattggattcagaccaaagatggtcaatgcggcagtccgctggtttccacccgtgacggtttcatcgtcggcattcactcagcgtcgaactttacgaataccaacaattacttcacgtccgttccgaaaaactttatggaactgctgaccaatcaggaagcgcagcaatgggtgtcaggttggcgcctgaatgccgattcggttctgtggggcggtcacaaagtctttatggtgaaaccggaagaaccgttccagccggtcaaagaagcaacccaactgatgaatgaactggtctactcccaa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z