BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_G0002 1 SX scar SpeI/XbaI mixed site 2007-02-26T12:00:00Z 2015-08-31T04:07:27Z XbaI and SpeI sites XbaI/SpeI mixed site. Simply used to aid in entry of parts into the registry. false true _41_ 0 126 70 Not in stock false None. false Reshma Shetty BBa_J18918 1 TEVsite TEV cleavage site (E. coli) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis TEV cleaves the following AA sequence with high specificity: * Glu-Asn-Leu-Tyr-Phe-Gln&#8595;Gly but: * Glu-Asn-Leu-Tyr-Phe-Gln&#8595;Ser is also reported Note, the part suggested by the Voigt lab, also contains 2 additional 1xGly flanks for increased accessibility. See also: * BBa_I712077 (TEV N-term) * BBa_I712078 (TEV C-term) * BBa_I712016 (myri+TEV site, Slovenia team igem2007) * BBa_J64007 (Dan Widmaier, Voigt lab) References =========== Dougherty et al. (1989): Molecular genetic analysis of a plant virus polyprotein cleavage site: a model. PMID: 2669323 false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_G0000 1 scar SpeI/XbaI scar for RBS-CDS junctions 2007-07-22T11:00:00Z 2015-08-31T04:07:27Z SpeI/XbaI scar This is the sequence of the SpeI/XbaI scar for RBS-CDS junctions in BioBricks standard assembly. false true _41_ 0 126 162 Not in stock false This is a shorter scar to ensure proper spacing between the RBS and CDS. false Reshma Shetty BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K1319107 1 Scar25 TAA RFC 25 Translation Stop Scar Sequence 2014-10-02T11:00:00Z 2015-05-08T01:09:51Z This sequence is produced by an assembly method. This sequence is produced by RFC10-assembly of a RFC25-CDS with a RFC10-prefixed part. false false _1694_ 0 19522 9 Not in stock false The resulting sequence is a combination of 9 nucleotides from the RFC25 prefix (acc ggt taa) and the RFC10 scar (tactagag). false Michael Osthege annotation2393318 1 stop range2393318 1 7 9 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1319014 1 BBa_K1319014 Constitutive expression of GFP-REACh2 fusion protein 2014-10-04T11:00:00Z 2015-05-08T01:09:50Z The part is combined from other BioBricks This part expresses a E0040.K1319002 fusion protein (EGFP-REACh1) behind a J23101 promotor. false false _1694_ 0 19522 9 Not in stock true We designed this part to be very similar to I20260 and the other fusion parts (K1319013 and K1319015). false Florian Gohr, Arne Zimmermann, Michael Osthege component2395292 1 BBa_B0105 component2395284 1 BBa_B0032 component2395290 1 BBa_J18918 component2395296 1 BBa_K1319107 component2395294 1 BBa_K1319002 component2395286 1 BBa_G0000 component2395287 1 BBa_K1051003 component2395281 1 BBa_J23101 component2395303 1 BBa_B0015 component2395282 1 BBa_G0002 component2395289 1 BBa_B0105 annotation2395284 1 BBa_B0032 range2395284 1 44 56 annotation2395282 1 BBa_G0002 range2395282 1 36 43 annotation2395287 1 BBa_K1051003 range2395287 1 63 776 annotation2395296 1 BBa_K1319107 range2395296 1 1521 1537 annotation2395286 1 BBa_G0000 range2395286 1 57 62 annotation2395294 1 BBa_K1319002 range2395294 1 810 1520 annotation2395289 1 BBa_B0105 range2395289 1 777 782 annotation2395290 1 BBa_J18918 range2395290 1 783 803 annotation2395281 1 BBa_J23101 range2395281 1 1 35 annotation2395292 1 BBa_B0105 range2395292 1 804 809 annotation2395303 1 BBa_B0015 range2395303 1 1538 1666 BBa_K1051003 1 BBa_K1051003 Stop codon free GFP in RFC[23] standard 2013-07-03T11:00:00Z 2015-05-08T01:08:53Z kit GFP without stop coding false false _1358_ 0 15912 9 In stock false add prefix suffix del stop coding false Xiang LI BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1319002 1 REACh2 RFC[25]-compatible dark quencher based on K1319000 (E0030) 2014-09-29T11:00:00Z 2015-05-08T01:09:50Z The part is derived from K1319000. This part is a RFC[25] dark quencher that is based upon K1319000 (the RFC[25] version of E0030/EYFP). Three mutations were introduced that eliminated fluorescence: * L90I * Y145W * H148R false false _1694_ 0 19522 9 In stock false Point mutations were introduced, starting from K1319000 (RFC25-YFP) as the template. false Michael Osthege, Florian Gohr annotation2390763 1 REACh2 range2390763 1 1 711 BBa_B0105_sequence 1 accggc BBa_K1319107_sequence 1 accggttaatactagag BBa_J18918_sequence 1 gaaaacctgtattttcagggc BBa_K1319002_sequence 1 gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccatcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactggaacagccgcaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtac BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_G0000_sequence 1 tactag BBa_B0032_sequence 1 tcacacaggaaag BBa_K1051003_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_G0002_sequence 1 tactagag BBa_K1319014_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaccggcgaaaacctgtattttcagggcaccggcgtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccatcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactggaacagccgcaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaccggttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z