BBa_K174017 1 BBa_K174017 CadA promoter with CzrA binding site 2009-10-13T11:00:00Z 2015-07-24T01:17:17Z It is taken from ''B. subtilis'' ''cadA'' promoter. In ''B. subtilis'' CadA system works as an efflux system to take the metals out in the cell. It is normally repressed by CzrA repressor protein. When certain metals get inside the cell, they can bind to CzrA and derepress the promoter expressing CadA. Hence metals are taken out by the efflux system. By taking the promoter of CadA system, we created a generic metal sensor. Hence when it is combined with coding sequences of other genes, it will regulate the expression of these genes upon sensing metals. false false _277_ 4206 3942 9 Not in stock false It was developed mainly to use combinatorial approaches for metal sensing false The Newcastle 2009 iGEM team annotation2040828 1 sigA -35 range2040828 1 18 23 annotation2040829 1 sigA -10 range2040829 1 42 47 annotation2040830 1 CzrA binding site range2040830 1 56 86 annotation2040827 1 cadA promoter range2040827 1 11 144 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_I746361 1 BBa_I746361 PO promoter from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z The source of the DNA is the P2 phage genome. Released HQ 2013 This is the PO promoter taken from the P2 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PO promoter. false false _116_ 0 2122 9 In stock false no special considerations true Stefan Milde annotation1943784 1 PO range1943784 1 1 92 BBa_K1320000 1 BBa_K1320000 Cd sensitive promoter with Ogr activator, PO promoter, and GFP 2014-09-17T11:00:00Z 2015-05-08T01:09:51Z This composite is composed of parts already in the registry. The cadmium sensitive promoter catalyzes the production of the Ogr activator. The activator triggers the PO promoter causing the production of GFP at greater levels than the cadmium promoter alone. false false _1695_ 0 14079 9 It's complicated false None. false Will Reiber component2383894 1 BBa_B0012 component2383891 1 BBa_E0040 component2383878 1 BBa_K174016 component2383883 1 BBa_K174017 component2383889 1 BBa_I746361 component2383887 1 BBa_I746350 component2383892 1 BBa_B0010 annotation2383891 1 BBa_E0040 range2383891 1 557 1276 annotation2383887 1 BBa_I746350 range2383887 1 214 450 annotation2383892 1 BBa_B0010 range2383892 1 1285 1364 annotation2383883 1 BBa_K174017 range2383883 1 35 205 annotation2383878 1 BBa_K174016 range2383878 1 1 26 annotation2383894 1 BBa_B0012 range2383894 1 1373 1413 annotation2383889 1 BBa_I746361 range2383889 1 459 550 BBa_I746350 1 BBa_I746350 ogr activator from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The ogr activator taken from P2 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943865 1 B0034 range1943865 1 1 12 annotation1943867 1 P2 ogr range1943867 1 19 237 annotation1943866 1 P2 ogr range1943866 1 19 19 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K174016 1 BBa_K174016 Promoterless ArsR binding site 2009-10-13T11:00:00Z 2015-07-24T01:17:49Z ''B. subtilis'' This part purely holds the binding site for ArsR protein which can be released when bound to different metals. Hence this part can be combined with any promoter to sense metals that can bind to ArsR protein. When added in front of a promoter with another metal sensor's protein's binding site, it can form an AND gate to sensitively detect specific metals. false false _277_ 4206 3942 9 Not in stock false It was developed mainly to use combinatorial approaches for metal sensing. false The Newcastle 2009 iGEM team annotation2040774 1 ArsR binding site range2040774 1 9 26 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I746361_sequence 1 cgcgccccgcgattcgctaaggtgctgttgtgtcagtgataagccatccgggactgatggcggaggatgcgcatcgtcgggaaactgatgcc BBa_K174017_sequence 1 gcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagc BBa_I746350_sequence 1 aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaa BBa_K1320000_sequence 1 agtaatcaaaataaattgatttattttactagaggcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagctactagagaaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatcatcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgcacccgttgccatcagggcagcaaattatgtggatgtaatactagagcgcgccccgcgattcgctaaggtgctgttgtgtcagtgataagccatccgggactgatggcggaggatgcgcatcgtcgggaaactgatgcctactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K174016_sequence 1 agtaatcaaaataaattgatttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z