BBa_K1321003 1 BBa_K1321003 Re-entry of BBa_K863101, Cellulose Binding Domain CBDcex in rfc25 2014-10-09T11:00:00Z 2015-06-17T12:35:33Z This is a direct copy of BBa_K863101 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. This part is a copy of BBa_K863101 (Cellulose binding Domain of Cellulomonas Fimi Exoglucanse (Freiburg-Standard)) and was created only as a registry entry, removing the atg-NgoMIV parts at the front and the AgeI-taa basepairs from the sequence so that the registry does not flag it as rfc25 incompatible, and it enables us to enter fusion proteins with this part as automatic composite parts in the method as described by: http://2009.igem.org/Team:Freiburg_bioware/general. false false _1696_ 4206 20780 9 Not in stock false This is a direct copy of BBa_K863101 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. false Xenia Spencer-Milnes BBa_K1321003_sequence 1 ggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtcaccgtgaagaacacgtcctccgctccggtagacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtcacgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacgggcaccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggcggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z