BBa_K1321014 1 BBa_K1321014 CBDCipA with N and C-terminal linker 2014-10-14T11:00:00Z 2015-06-17T12:14:33Z The designed construct was ordered from as a GeneArt?? String (Invitrogen??? Life Technologies). This CBD is from the Cellulosomal -scaffolding protein A (cipA) of Clostridium thermocellum including the endogenous linker sequences at the N and C-terminus (UniProt ID Q06851 link http://www.uniprot.org/uniprot/Q06851). It is in RFC25 format to allow for easy use in protein fusions. The CBD is part of the CBM3 family (link to cazy http://www.cazy.org/CBM3.html). This CBD has been used in many application: in fusions with cell adhesion peptides to enhance the properties of cellulose as a cell-growth matrix (Andrade <i>et al </i> 2010a, Andrade <i>et al </i> 2010b), fused to enzymes to remove contaminants from water (Kauffmann <i> et al </i> 2000) and fused to an antimicrobial peptide (Ramos, Domingues & Gama 2010). At present the cloning for these constructs is still in progress to correct an illegal EcoRI site which was identified in the parts with this CBD. This can be achieved with a silent mutation via site-directed mutagenesis and we aim to send these parts to the registry once this is complete. false false _1696_ 4206 20780 9 Not in stock true The DNA sequence from the relevant portion of http://www.ncbi.nlm.nih.gov/nuccore/144777 was codon optimised for ''E.coli''. RFC[25] prefix and suffix were appended to the sequence with an additional 4 basepairs (gatc) at the beginning and end to allow space for the restriction enzymes to bind to the EcoRI and PstI sites at the ends of the sequence for cloning purposes. false Xenia Spencer-Milnes annotation2420187 1 Endogenous Linker (C-term) range2420187 1 604 711 annotation2420141 1 Endogenous Linker (N-term) range2420141 1 1 126 annotation2420186 1 CBDcipA range2420186 1 127 603 BBa_K1321014_sequence 1 aatgctacgccaactaagggtgcaaccccgaccaacacagcaacgcctacaaaaagcgctacagcaacacctacaagaccgtcagttcctacaaacacaccgactaacacaccggcaaatacacctgtttcaggcaacttgaaggtcgaattctataactcaaatccgagtgatacaactaacagtattaatccgcagtttaaagtaacaaatacaggatcaagtgcaattgatctttcaaagcttacattgagatactattacaccgttgatggccagaaggaccagactttctggtgtgaccatgcagctatcataggtagcaacggctcatacaacggcatcacatcaaatgtaaaaggaacattcgtaaagatgagctcaagcacaaataacgcagacacatacctcgaaataagtttcacaggtggcactttggaacctggtgctcatgtacagatacagggtaggtttgcgaaaaatgactggagtaattatacacagtcaaatgattactcatttaagtcagcatcacagttcgtagaatgggatcaggttacagcatatttgaatggagtacttgtatggggtaaagaaccaggaggatcagtagttccgtcaacacagccggtaacaaccccaccggcaacaaccaagccgccagcaacaaccaaaccaccggctaccacgattcctccatcagacgatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z