BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321091 1 BBa_K1321091 Phytochelatin (PC) EC20 fused to CBDclos 2014-10-06T11:00:00Z 2015-06-17T12:34:24Z PhytoC+CBD4. TBC PhytoC+CBD4. TBC false false _1696_ 4206 20780 9 It's complicated false PhytoC+CBD4. TBC false Xenia Spencer-Milnes component2414580 1 BBa_B0105 component2414578 1 BBa_K1321005 component2414581 1 BBa_K1321002 annotation2414581 1 BBa_K1321002 range2414581 1 148 447 annotation2414578 1 BBa_K1321005 range2414578 1 1 141 annotation2414580 1 BBa_B0105 range2414580 1 142 147 BBa_K1321005 1 BBa_K1321005 Synthetic Phytochelatin EC(20) RFC[25] 2014-10-06T11:00:00Z 2015-05-08T01:09:51Z Sequence is not natural. Basis for the sequence was from the following reference: Bae W, Chen W, Mulchandani A, Mehra RK (2000) Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnol Bioeng. 70(5):518-24. Synthetic Phytochelatin EC(20) rfc25 fusion format false false _1696_ 0 20780 9 In stock true Codon optimised for E.coli. false Xenia Spencer-Milnes annotation2414598 1 Synthetic Phytochelatin EC(20) range2414598 1 1 123 BBa_K1321002 1 BBa_K1321002 Re-entry of BBa_K863111, Cellulose Binding Domain CBDclos in rfc25 2014-10-09T11:00:00Z 2015-06-17T12:35:41Z This is a direct copy of BBa_K863111 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. This part is a copy of BBa_K863111 (Cellulose binding domain of C. cellulovorans cellulose binding protein gene (Freiburg-Standard)) and was created only as a registry entry, removing the atg-NgoMIV parts at the front and the AgeI-taa basepairs from the sequence so that the registry does not flag it as rfc25 incompatible, and it enables us to enter fusion proteins with this part as automatic composite parts in the method as described by: http://2009.igem.org/Team:Freiburg_bioware/general. false false _1696_ 4206 20780 9 Not in stock false This is a direct copy of BBa_K863111 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. false Xenia Spencer-Milnes BBa_B0105_sequence 1 accggc BBa_K1321005_sequence 1 gaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggc BBa_K1321091_sequence 1 atggccggcgaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggcaccggttaaaccggctcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagc BBa_K1321002_sequence 1 tcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z