BBa_K1321005 1 BBa_K1321005 Synthetic Phytochelatin EC(20) RFC[25] 2014-10-06T11:00:00Z 2015-05-08T01:09:51Z Sequence is not natural. Basis for the sequence was from the following reference: Bae W, Chen W, Mulchandani A, Mehra RK (2000) Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnol Bioeng. 70(5):518-24. Synthetic Phytochelatin EC(20) rfc25 fusion format false false _1696_ 0 20780 9 In stock true Codon optimised for E.coli. false Xenia Spencer-Milnes annotation2414598 1 Synthetic Phytochelatin EC(20) range2414598 1 1 123 BBa_K1321338 1 BBa_K1321338 T7 Expression vector 2014-10-07T11:00:00Z 2015-05-08T01:09:53Z asdf asdfasdf false false _1696_ 0 20830 9 In stock false asdf false Chris N Micklem component2402301 1 BBa_B0034 component2402299 1 BBa_I719005 annotation2402299 1 BBa_I719005 range2402299 1 1 23 annotation2402301 1 BBa_B0034 range2402301 1 32 43 BBa_K1321014 1 BBa_K1321014 CBDCipA with N and C-terminal linker 2014-10-14T11:00:00Z 2015-06-17T12:14:33Z The designed construct was ordered from as a GeneArt?? String (Invitrogen??? Life Technologies). This CBD is from the Cellulosomal -scaffolding protein A (cipA) of Clostridium thermocellum including the endogenous linker sequences at the N and C-terminus (UniProt ID Q06851 link http://www.uniprot.org/uniprot/Q06851). It is in RFC25 format to allow for easy use in protein fusions. The CBD is part of the CBM3 family (link to cazy http://www.cazy.org/CBM3.html). This CBD has been used in many application: in fusions with cell adhesion peptides to enhance the properties of cellulose as a cell-growth matrix (Andrade <i>et al </i> 2010a, Andrade <i>et al </i> 2010b), fused to enzymes to remove contaminants from water (Kauffmann <i> et al </i> 2000) and fused to an antimicrobial peptide (Ramos, Domingues & Gama 2010). At present the cloning for these constructs is still in progress to correct an illegal EcoRI site which was identified in the parts with this CBD. This can be achieved with a silent mutation via site-directed mutagenesis and we aim to send these parts to the registry once this is complete. false false _1696_ 4206 20780 9 Not in stock true The DNA sequence from the relevant portion of http://www.ncbi.nlm.nih.gov/nuccore/144777 was codon optimised for ''E.coli''. RFC[25] prefix and suffix were appended to the sequence with an additional 4 basepairs (gatc) at the beginning and end to allow space for the restriction enzymes to bind to the EcoRI and PstI sites at the ends of the sequence for cloning purposes. false Xenia Spencer-Milnes annotation2420186 1 CBDcipA range2420186 1 127 603 annotation2420187 1 Endogenous Linker (C-term) range2420187 1 604 711 annotation2420141 1 Endogenous Linker (N-term) range2420141 1 1 126 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1321093 1 BBa_K1321093 Phytochelatin (PC) EC20 + Linker-CBDcipA-Linker 2014-10-08T11:00:00Z 2015-06-17T12:35:00Z GATC GATC false false _1696_ 4206 20961 9 Not in stock false GATC false Gabriella Santosa component2423517 1 BBa_K1321014 component2423511 1 BBa_K1321005 component2423513 1 BBa_B0105 annotation2423517 1 BBa_K1321014 range2423517 1 130 840 annotation2423513 1 BBa_B0105 range2423513 1 124 129 annotation2423511 1 BBa_K1321005 range2423511 1 1 123 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321103 1 BBa_K1321103 Phytochelatin (PC) EC20 + linker-CBDcipA-linker with T7 promoter 2014-10-08T11:00:00Z 2015-05-08T01:09:51Z PhytoC+CBD10 PhytoC+CBD10 false false _1696_ 0 20780 9 Not in stock false PhytoC+CBD10 false Xenia Spencer-Milnes component2423636 1 BBa_K1321093 component2423625 1 BBa_K1321338 component2423627 1 BBa_K1319106 annotation2423625 1 BBa_K1321338 range2423625 1 1 43 annotation2423627 1 BBa_K1319106 range2423627 1 44 58 annotation2423636 1 BBa_K1321093 range2423636 1 59 898 BBa_K1319106 1 Scar25 ATG RFC 25 Translation Start Scar Sequence 2014-10-02T11:00:00Z 2015-05-08T01:09:51Z This sequence is produced by an assembly method. This sequence is produced by RFC10-assembly of a RFC10-RBS with a RFC25-prefixed part. false false _1694_ 0 19522 9 Not in stock false The resulting sequence is a combination of the RFC10 RBS-CDS scar (tactag) and 9 nucleotides from the RFC25 prefix (atg gcc ggc). false Michael Osthege annotation2393317 1 start range2393317 1 7 9 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0105_sequence 1 accggc BBa_K1321093_sequence 1 gaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggcaccggcaatgctacgccaactaagggtgcaaccccgaccaacacagcaacgcctacaaaaagcgctacagcaacacctacaagaccgtcagttcctacaaacacaccgactaacacaccggcaaatacacctgtttcaggcaacttgaaggtcgaattctataactcaaatccgagtgatacaactaacagtattaatccgcagtttaaagtaacaaatacaggatcaagtgcaattgatctttcaaagcttacattgagatactattacaccgttgatggccagaaggaccagactttctggtgtgaccatgcagctatcataggtagcaacggctcatacaacggcatcacatcaaatgtaaaaggaacattcgtaaagatgagctcaagcacaaataacgcagacacatacctcgaaataagtttcacaggtggcactttggaacctggtgctcatgtacagatacagggtaggtttgcgaaaaatgactggagtaattatacacagtcaaatgattactcatttaagtcagcatcacagttcgtagaatgggatcaggttacagcatatttgaatggagtacttgtatggggtaaagaaccaggaggatcagtagttccgtcaacacagccggtaacaaccccaccggcaacaaccaagccgccagcaacaaccaaaccaccggctaccacgattcctccatcagacgatccg BBa_K1321005_sequence 1 gaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggc BBa_K1321014_sequence 1 aatgctacgccaactaagggtgcaaccccgaccaacacagcaacgcctacaaaaagcgctacagcaacacctacaagaccgtcagttcctacaaacacaccgactaacacaccggcaaatacacctgtttcaggcaacttgaaggtcgaattctataactcaaatccgagtgatacaactaacagtattaatccgcagtttaaagtaacaaatacaggatcaagtgcaattgatctttcaaagcttacattgagatactattacaccgttgatggccagaaggaccagactttctggtgtgaccatgcagctatcataggtagcaacggctcatacaacggcatcacatcaaatgtaaaaggaacattcgtaaagatgagctcaagcacaaataacgcagacacatacctcgaaataagtttcacaggtggcactttggaacctggtgctcatgtacagatacagggtaggtttgcgaaaaatgactggagtaattatacacagtcaaatgattactcatttaagtcagcatcacagttcgtagaatgggatcaggttacagcatatttgaatggagtacttgtatggggtaaagaaccaggaggatcagtagttccgtcaacacagccggtaacaaccccaccggcaacaaccaagccgccagcaacaaccaaaccaccggctaccacgattcctccatcagacgatccg BBa_B0034_sequence 1 aaagaggagaaa BBa_K1321338_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaa BBa_K1319106_sequence 1 tactagatggccggc BBa_K1321103_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatggccggcgaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggcaccggcaatgctacgccaactaagggtgcaaccccgaccaacacagcaacgcctacaaaaagcgctacagcaacacctacaagaccgtcagttcctacaaacacaccgactaacacaccggcaaatacacctgtttcaggcaacttgaaggtcgaattctataactcaaatccgagtgatacaactaacagtattaatccgcagtttaaagtaacaaatacaggatcaagtgcaattgatctttcaaagcttacattgagatactattacaccgttgatggccagaaggaccagactttctggtgtgaccatgcagctatcataggtagcaacggctcatacaacggcatcacatcaaatgtaaaaggaacattcgtaaagatgagctcaagcacaaataacgcagacacatacctcgaaataagtttcacaggtggcactttggaacctggtgctcatgtacagatacagggtaggtttgcgaaaaatgactggagtaattatacacagtcaaatgattactcatttaagtcagcatcacagttcgtagaatgggatcaggttacagcatatttgaatggagtacttgtatggggtaaagaaccaggaggatcagtagttccgtcaacacagccggtaacaaccccaccggcaacaaccaagccgccagcaacaaccaaaccaccggctaccacgattcctccatcagacgatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z