BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K1321104 1 BBa_K1321104 CBDclos fused to Phytochelatin (PC) EC20 with T7 promoter 2014-10-08T11:00:00Z 2015-06-17T12:18:25Z CBD4+PhytoC CBD4+PhytoC false false _1696_ 4206 20780 9 In stock false CBD4+PhytoC false Xenia Spencer-Milnes component2420131 1 BBa_K1321002 component2420135 1 BBa_K1321005 component2420133 1 BBa_B0105 component2420128 1 BBa_K1321338 component2420130 1 BBa_K1319106 annotation2420131 1 BBa_K1321002 range2420131 1 59 358 annotation2420133 1 BBa_B0105 range2420133 1 359 364 annotation2420135 1 BBa_K1321005 range2420135 1 365 487 annotation2420128 1 BBa_K1321338 range2420128 1 1 43 annotation2420130 1 BBa_K1319106 range2420130 1 44 58 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1319106 1 Scar25 ATG RFC 25 Translation Start Scar Sequence 2014-10-02T11:00:00Z 2015-05-08T01:09:51Z This sequence is produced by an assembly method. This sequence is produced by RFC10-assembly of a RFC10-RBS with a RFC25-prefixed part. false false _1694_ 0 19522 9 Not in stock false The resulting sequence is a combination of the RFC10 RBS-CDS scar (tactag) and 9 nucleotides from the RFC25 prefix (atg gcc ggc). false Michael Osthege annotation2393317 1 start range2393317 1 7 9 BBa_K1321005 1 BBa_K1321005 Synthetic Phytochelatin EC(20) RFC[25] 2014-10-06T11:00:00Z 2015-05-08T01:09:51Z Sequence is not natural. Basis for the sequence was from the following reference: Bae W, Chen W, Mulchandani A, Mehra RK (2000) Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnol Bioeng. 70(5):518-24. Synthetic Phytochelatin EC(20) rfc25 fusion format false false _1696_ 0 20780 9 In stock true Codon optimised for E.coli. false Xenia Spencer-Milnes annotation2414598 1 Synthetic Phytochelatin EC(20) range2414598 1 1 123 BBa_K1321002 1 BBa_K1321002 Re-entry of BBa_K863111, Cellulose Binding Domain CBDclos in rfc25 2014-10-09T11:00:00Z 2015-06-17T12:35:41Z This is a direct copy of BBa_K863111 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. This part is a copy of BBa_K863111 (Cellulose binding domain of C. cellulovorans cellulose binding protein gene (Freiburg-Standard)) and was created only as a registry entry, removing the atg-NgoMIV parts at the front and the AgeI-taa basepairs from the sequence so that the registry does not flag it as rfc25 incompatible, and it enables us to enter fusion proteins with this part as automatic composite parts in the method as described by: http://2009.igem.org/Team:Freiburg_bioware/general. false false _1696_ 4206 20780 9 Not in stock false This is a direct copy of BBa_K863111 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. false Xenia Spencer-Milnes BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321338 1 BBa_K1321338 T7 Expression vector 2014-10-07T11:00:00Z 2015-05-08T01:09:53Z asdf asdfasdf false false _1696_ 0 20830 9 In stock false asdf false Chris N Micklem component2402299 1 BBa_I719005 component2402301 1 BBa_B0034 annotation2402301 1 BBa_B0034 range2402301 1 32 43 annotation2402299 1 BBa_I719005 range2402299 1 1 23 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0105_sequence 1 accggc BBa_K1321005_sequence 1 gaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1321338_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaa BBa_K1321002_sequence 1 tcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagc BBa_K1319106_sequence 1 tactagatggccggc BBa_K1321104_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatggccggctcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagcaccggcgaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z