BBa_K1321011 1 BBa_K1321011 SmtA metallothionein in Freiburg format (RFC[25]) 2014-10-09T11:00:00Z 2015-05-08T01:09:51Z Source from BBa_____ SmtA metallothionein in rfc25 format. This part is based on BBa_____ but has been codon optimised for E.coli and is in the rfc25 biobrick format for ease of use as part of protein fusions. This part is available as fusions as follows: false false _1696_ 0 20780 9 Not in stock false Codon optimised for E.coli. rbs not included in the part as it is for fusions false Xenia Spencer-Milnes annotation2414600 1 SmtA range2414600 1 1 165 BBa_K1321126 1 BBa_K1321126 linker-CBDcipA-linker + metallothionein SmtA 2014-10-08T11:00:00Z 2015-05-08T01:09:52Z GATC GATC false false _1696_ 0 20961 9 It's complicated false GATC false Gabriella Santosa component2428071 1 BBa_K1321014 component2428075 1 BBa_K1321011 component2428073 1 BBa_B0105 annotation2428073 1 BBa_B0105 range2428073 1 712 717 annotation2428075 1 BBa_K1321011 range2428075 1 718 882 annotation2428071 1 BBa_K1321014 range2428071 1 1 711 BBa_K1321014 1 BBa_K1321014 CBDCipA with N and C-terminal linker 2014-10-14T11:00:00Z 2015-06-17T12:14:33Z The designed construct was ordered from as a GeneArt?? String (Invitrogen??? Life Technologies). This CBD is from the Cellulosomal -scaffolding protein A (cipA) of Clostridium thermocellum including the endogenous linker sequences at the N and C-terminus (UniProt ID Q06851 link http://www.uniprot.org/uniprot/Q06851). It is in RFC25 format to allow for easy use in protein fusions. The CBD is part of the CBM3 family (link to cazy http://www.cazy.org/CBM3.html). This CBD has been used in many application: in fusions with cell adhesion peptides to enhance the properties of cellulose as a cell-growth matrix (Andrade <i>et al </i> 2010a, Andrade <i>et al </i> 2010b), fused to enzymes to remove contaminants from water (Kauffmann <i> et al </i> 2000) and fused to an antimicrobial peptide (Ramos, Domingues & Gama 2010). At present the cloning for these constructs is still in progress to correct an illegal EcoRI site which was identified in the parts with this CBD. This can be achieved with a silent mutation via site-directed mutagenesis and we aim to send these parts to the registry once this is complete. false false _1696_ 4206 20780 9 Not in stock true The DNA sequence from the relevant portion of http://www.ncbi.nlm.nih.gov/nuccore/144777 was codon optimised for ''E.coli''. RFC[25] prefix and suffix were appended to the sequence with an additional 4 basepairs (gatc) at the beginning and end to allow space for the restriction enzymes to bind to the EcoRI and PstI sites at the ends of the sequence for cloning purposes. false Xenia Spencer-Milnes annotation2420141 1 Endogenous Linker (N-term) range2420141 1 1 126 annotation2420186 1 CBDcipA range2420186 1 127 603 annotation2420187 1 Endogenous Linker (C-term) range2420187 1 604 711 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321011_sequence 1 accagcaccaccctggttaaatgtgcatgtgaaccgtgtctgtgtaatgttgatccgagcaaagcaattgatcgcaatggtctgtattattgtagcgaagcatgtgcagatggtcatacaggtggtagcaaaggttgtggtcataccggctgtaattgtcatggc BBa_B0105_sequence 1 accggc BBa_K1321014_sequence 1 aatgctacgccaactaagggtgcaaccccgaccaacacagcaacgcctacaaaaagcgctacagcaacacctacaagaccgtcagttcctacaaacacaccgactaacacaccggcaaatacacctgtttcaggcaacttgaaggtcgaattctataactcaaatccgagtgatacaactaacagtattaatccgcagtttaaagtaacaaatacaggatcaagtgcaattgatctttcaaagcttacattgagatactattacaccgttgatggccagaaggaccagactttctggtgtgaccatgcagctatcataggtagcaacggctcatacaacggcatcacatcaaatgtaaaaggaacattcgtaaagatgagctcaagcacaaataacgcagacacatacctcgaaataagtttcacaggtggcactttggaacctggtgctcatgtacagatacagggtaggtttgcgaaaaatgactggagtaattatacacagtcaaatgattactcatttaagtcagcatcacagttcgtagaatgggatcaggttacagcatatttgaatggagtacttgtatggggtaaagaaccaggaggatcagtagttccgtcaacacagccggtaacaaccccaccggcaacaaccaagccgccagcaacaaccaaaccaccggctaccacgattcctccatcagacgatccg BBa_K1321126_sequence 1 aatgctacgccaactaagggtgcaaccccgaccaacacagcaacgcctacaaaaagcgctacagcaacacctacaagaccgtcagttcctacaaacacaccgactaacacaccggcaaatacacctgtttcaggcaacttgaaggtcgaattctataactcaaatccgagtgatacaactaacagtattaatccgcagtttaaagtaacaaatacaggatcaagtgcaattgatctttcaaagcttacattgagatactattacaccgttgatggccagaaggaccagactttctggtgtgaccatgcagctatcataggtagcaacggctcatacaacggcatcacatcaaatgtaaaaggaacattcgtaaagatgagctcaagcacaaataacgcagacacatacctcgaaataagtttcacaggtggcactttggaacctggtgctcatgtacagatacagggtaggtttgcgaaaaatgactggagtaattatacacagtcaaatgattactcatttaagtcagcatcacagttcgtagaatgggatcaggttacagcatatttgaatggagtacttgtatggggtaaagaaccaggaggatcagtagttccgtcaacacagccggtaacaaccccaccggcaacaaccaagccgccagcaacaaccaaaccaccggctaccacgattcctccatcagacgatccgaccggcaccagcaccaccctggttaaatgtgcatgtgaaccgtgtctgtgtaatgttgatccgagcaaagcaattgatcgcaatggtctgtattattgtagcgaagcatgtgcagatggtcatacaggtggtagcaaaggttgtggtcataccggctgtaattgtcatggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z