BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K1319106 1 Scar25 ATG RFC 25 Translation Start Scar Sequence 2014-10-02T11:00:00Z 2015-05-08T01:09:51Z This sequence is produced by an assembly method. This sequence is produced by RFC10-assembly of a RFC10-RBS with a RFC25-prefixed part. false false _1694_ 0 19522 9 Not in stock false The resulting sequence is a combination of the RFC10 RBS-CDS scar (tactag) and 9 nucleotides from the RFC25 prefix (atg gcc ggc). false Michael Osthege annotation2393317 1 start range2393317 1 7 9 BBa_K1321159 1 BBa_K1321159 Fmt metallothionein with T7 promoter 2014-10-08T11:00:00Z 2015-05-08T01:09:52Z GATC GATC false false _1696_ 0 20961 9 In stock false GATC false Gabriella Santosa component2414969 1 BBa_K1321012 component2414967 1 BBa_K1319106 component2414965 1 BBa_K1321338 annotation2414965 1 BBa_K1321338 range2414965 1 1 43 annotation2414969 1 BBa_K1321012 range2414969 1 59 256 annotation2414967 1 BBa_K1319106 range2414967 1 44 58 BBa_K1321012 1 BBa_K1321012 fMT metallothionein in Freiburg format (RFC[25]) 2014-10-09T11:00:00Z 2015-05-08T01:09:51Z From part BBa___ except codon optimised fMT metallothionein in rfc25 format. This part is based on BBa_____. It can be found as fusions in the following parts: false false _1696_ 0 20780 9 Not in stock false From part BBa___ except codon optimised false Xenia Spencer-Milnes annotation2414611 1 fMT range2414611 1 1 198 BBa_K1321338 1 BBa_K1321338 T7 Expression vector 2014-10-07T11:00:00Z 2015-05-08T01:09:53Z asdf asdfasdf false false _1696_ 0 20830 9 In stock false asdf false Chris N Micklem component2402299 1 BBa_I719005 component2402301 1 BBa_B0034 annotation2402299 1 BBa_I719005 range2402299 1 1 23 annotation2402301 1 BBa_B0034 range2402301 1 32 43 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_K1321159_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatggccggcgcaggtacaggttgtaaaatttgggaagattgtaaatgtggtgcagcatgtagctgtggtgatagctgtacctgtggcaccgttaaaaaaggtacaaccagccgtgccggtgcaggttgtccgtgtggtccgaaatgtaaatgtacaggtcagggtagctgtaactgcgttaaagatgattgttgtggttgtggcaaa BBa_K1321338_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaa BBa_K1319106_sequence 1 tactagatggccggc BBa_K1321012_sequence 1 gcaggtacaggttgtaaaatttgggaagattgtaaatgtggtgcagcatgtagctgtggtgatagctgtacctgtggcaccgttaaaaaaggtacaaccagccgtgccggtgcaggttgtccgtgtggtccgaaatgtaaatgtacaggtcagggtagctgtaactgcgttaaagatgattgttgtggttgtggcaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z