BBa_K1321340 1 BBa_K1321340 Double CBD (dCBD) with N-terminal linker 2014-10-07T11:00:00Z 2015-06-17T12:14:46Z asdf dCBD with N-terminal linker. false false _1696_ 4206 20830 9 In stock true asdf false Chris N Micklem annotation2417851 1 cbh1 CBD range2417851 1 259 366 annotation2417848 1 Linker range2417848 1 1 72 annotation2417850 1 Linker range2417850 1 187 258 annotation2417849 1 cbh2 CBD range2417849 1 73 186 annotation2417847 1 dCBD range2417847 1 1 366 BBa_K1321345 1 BBa_K1321345 NiBP fused to dCBD with linker in RFC 25 2014-10-07T11:00:00Z 2015-06-17T12:25:54Z asdf asdf false false _1696_ 4206 20830 9 In stock false asdf false Chris N Micklem component2415112 1 BBa_B0105 component2415110 1 BBa_K1321009 component2415114 1 BBa_K1321340 annotation2415110 1 BBa_K1321009 range2415110 1 1 176 annotation2415114 1 BBa_K1321340 range2415114 1 183 548 annotation2415112 1 BBa_B0105 range2415112 1 177 182 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321009 1 BBa_K1321009 Nickel Binding Protein (NiBP) Freiburg format (RFC[25]) 2014-10-07T11:00:00Z 2015-05-08T01:09:51Z This part is based on the existing BioBrick BBa_K1151001 by the 2013 Salente Lecce iGEM team. Nickel Binding Protein in Freiburg format (RFC 25) to allow for easy use in fusion proteins. false false _1696_ 0 20830 9 In stock false OEPCR primers were designed to allow for the replacement of the standard BioBrick prefix and suffix with the Freiburg prefix and suffix. false Chris N Micklem annotation2416941 1 Nickel Binding Protein range2416941 1 1 176 BBa_B0105_sequence 1 accggc BBa_K1321345_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagaccggccccggcgccaatccgcccggtactacgaccacttcgcgtccagcaaccacgaccgggtcgagccccggcccacaggcctgttcttccgtctggggtcagtgcggcggacagaactggtctggccctacctgctgtgcttctggcagcacatgcgtctactctaacgactactatagccagtgcctgccgggtgctaacccgccaggcactaccactacctctcgccccgctaccactacaggctctagcccgggacctacccaaagccactacggccagtgcggaggcattggctacagcggccctaccgtctgcgcctccggaaccacctgccaagtcctgaacccgtactactcccagtgtctt BBa_K1321340_sequence 1 cccggcgccaatccgcccggtactacgaccacttcgcgtccagcaaccacgaccgggtcgagccccggcccacaggcctgttcttccgtctggggtcagtgcggcggacagaactggtctggccctacctgctgtgcttctggcagcacatgcgtctactctaacgactactatagccagtgcctgccgggtgctaacccgccaggcactaccactacctctcgccccgctaccactacaggctctagcccgggacctacccaaagccactacggccagtgcggaggcattggctacagcggccctaccgtctgcgcctccggaaccacctgccaagtcctgaacccgtactactcccagtgtctt BBa_K1321009_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z