BBa_K1321351 1 BBa_K1321351 CBDcenA with linker fused to NiBP in Freiburg format (RFC 25) 2014-10-07T11:00:00Z 2015-06-17T12:31:45Z asdf asdf false false _1696_ 4206 20830 9 In stock false asdf false Chris N Micklem component2430311 1 BBa_K1321009 component2430307 1 BBa_K1321339 component2430309 1 BBa_B0105 annotation2430311 1 BBa_K1321009 range2430311 1 415 590 annotation2430307 1 BBa_K1321339 range2430307 1 1 408 annotation2430309 1 BBa_B0105 range2430309 1 409 414 BBa_K1321339 1 BBa_K1321339 CBDcenA+Linker, RFC 25 standard 2014-10-07T11:00:00Z 2015-06-17T12:14:18Z asdf CBDcenA in Freiburg format (RFC 25). false false _1696_ 4206 20830 9 In stock true asdf false Chris N Micklem annotation2414614 1 Linker: Pro-Thr box range2414614 1 319 408 annotation2418065 1 CBDCenA range2418065 1 1 318 BBa_K1321009 1 BBa_K1321009 Nickel Binding Protein (NiBP) Freiburg format (RFC[25]) 2014-10-07T11:00:00Z 2015-05-08T01:09:51Z This part is based on the existing BioBrick BBa_K1151001 by the 2013 Salente Lecce iGEM team. Nickel Binding Protein in Freiburg format (RFC 25) to allow for easy use in fusion proteins. false false _1696_ 0 20830 9 In stock false OEPCR primers were designed to allow for the replacement of the standard BioBrick prefix and suffix with the Freiburg prefix and suffix. false Chris N Micklem annotation2416941 1 Nickel Binding Protein range2416941 1 1 176 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_B0105_sequence 1 accggc BBa_K1321351_sequence 1 gcgccgggttgccgtgttgactacgcggttaccaaccagtggccgggtggtttcggtgcgaacgttaccatcaccaacctgggtgacccggtttcttcttggaaactggactggacctacaccgcgggtcagcgtatccagcagctgtggaacggtaccgcgtctaccaacggtggtcaggtttctgttacctctctgccgtggaacggttctatcccgactggtggtaccgcgtctttcggtttcaacggttcttgggcgggttctaacccgaccccggcgtctttctctctgaacggtaccacctgcacgggtaccccgacgacctcgccaactcctacgccgaccccaaccacgccgactcctacaccgacgcccaccccaacgcctactccgacggtcacccccaccggcgcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgag BBa_K1321339_sequence 1 gcgccgggttgccgtgttgactacgcggttaccaaccagtggccgggtggtttcggtgcgaacgttaccatcaccaacctgggtgacccggtttcttcttggaaactggactggacctacaccgcgggtcagcgtatccagcagctgtggaacggtaccgcgtctaccaacggtggtcaggtttctgttacctctctgccgtggaacggttctatcccgactggtggtaccgcgtctttcggtttcaacggttcttgggcgggttctaacccgaccccggcgtctttctctctgaacggtaccacctgcacgggtaccccgacgacctcgccaactcctacgccgaccccaaccacgccgactcctacaccgacgcccaccccaacgcctactccgacggtcaccccc BBa_K1321009_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z