BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1321345 1 BBa_K1321345 NiBP fused to dCBD with linker in RFC 25 2014-10-07T11:00:00Z 2015-06-17T12:25:54Z asdf asdf false false _1696_ 4206 20830 9 In stock false asdf false Chris N Micklem component2415112 1 BBa_B0105 component2415114 1 BBa_K1321340 component2415110 1 BBa_K1321009 annotation2415110 1 BBa_K1321009 range2415110 1 1 176 annotation2415114 1 BBa_K1321340 range2415114 1 183 548 annotation2415112 1 BBa_B0105 range2415112 1 177 182 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K1321009 1 BBa_K1321009 Nickel Binding Protein (NiBP) Freiburg format (RFC[25]) 2014-10-07T11:00:00Z 2015-05-08T01:09:51Z This part is based on the existing BioBrick BBa_K1151001 by the 2013 Salente Lecce iGEM team. Nickel Binding Protein in Freiburg format (RFC 25) to allow for easy use in fusion proteins. false false _1696_ 0 20830 9 In stock false OEPCR primers were designed to allow for the replacement of the standard BioBrick prefix and suffix with the Freiburg prefix and suffix. false Chris N Micklem annotation2416941 1 Nickel Binding Protein range2416941 1 1 176 BBa_K1321364 1 BBa_K1321364 NiBP fused to dCBD with linker driven by T7 2014-10-07T11:00:00Z 2015-05-08T01:09:53Z asdf sadf false false _1696_ 0 20830 9 It's complicated false asdf false Chris N Micklem component2415662 1 BBa_K1321338 component2415670 1 BBa_K1321345 component2415664 1 BBa_K1319106 annotation2415670 1 BBa_K1321345 range2415670 1 59 606 annotation2415664 1 BBa_K1319106 range2415664 1 44 58 annotation2415662 1 BBa_K1321338 range2415662 1 1 43 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1319106 1 Scar25 ATG RFC 25 Translation Start Scar Sequence 2014-10-02T11:00:00Z 2015-05-08T01:09:51Z This sequence is produced by an assembly method. This sequence is produced by RFC10-assembly of a RFC10-RBS with a RFC25-prefixed part. false false _1694_ 0 19522 9 Not in stock false The resulting sequence is a combination of the RFC10 RBS-CDS scar (tactag) and 9 nucleotides from the RFC25 prefix (atg gcc ggc). false Michael Osthege annotation2393317 1 start range2393317 1 7 9 BBa_K1321338 1 BBa_K1321338 T7 Expression vector 2014-10-07T11:00:00Z 2015-05-08T01:09:53Z asdf asdfasdf false false _1696_ 0 20830 9 In stock false asdf false Chris N Micklem component2402299 1 BBa_I719005 component2402301 1 BBa_B0034 annotation2402301 1 BBa_B0034 range2402301 1 32 43 annotation2402299 1 BBa_I719005 range2402299 1 1 23 BBa_K1321340 1 BBa_K1321340 Double CBD (dCBD) with N-terminal linker 2014-10-07T11:00:00Z 2015-06-17T12:14:46Z asdf dCBD with N-terminal linker. false false _1696_ 4206 20830 9 In stock true asdf false Chris N Micklem annotation2417849 1 cbh2 CBD range2417849 1 73 186 annotation2417851 1 cbh1 CBD range2417851 1 259 366 annotation2417848 1 Linker range2417848 1 1 72 annotation2417847 1 dCBD range2417847 1 1 366 annotation2417850 1 Linker range2417850 1 187 258 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0105_sequence 1 accggc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1321345_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagaccggccccggcgccaatccgcccggtactacgaccacttcgcgtccagcaaccacgaccgggtcgagccccggcccacaggcctgttcttccgtctggggtcagtgcggcggacagaactggtctggccctacctgctgtgcttctggcagcacatgcgtctactctaacgactactatagccagtgcctgccgggtgctaacccgccaggcactaccactacctctcgccccgctaccactacaggctctagcccgggacctacccaaagccactacggccagtgcggaggcattggctacagcggccctaccgtctgcgcctccggaaccacctgccaagtcctgaacccgtactactcccagtgtctt BBa_K1321338_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaa BBa_K1321340_sequence 1 cccggcgccaatccgcccggtactacgaccacttcgcgtccagcaaccacgaccgggtcgagccccggcccacaggcctgttcttccgtctggggtcagtgcggcggacagaactggtctggccctacctgctgtgcttctggcagcacatgcgtctactctaacgactactatagccagtgcctgccgggtgctaacccgccaggcactaccactacctctcgccccgctaccactacaggctctagcccgggacctacccaaagccactacggccagtgcggaggcattggctacagcggccctaccgtctgcgcctccggaaccacctgccaagtcctgaacccgtactactcccagtgtctt BBa_K1319106_sequence 1 tactagatggccggc BBa_K1321364_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatggccggcgcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagaccggccccggcgccaatccgcccggtactacgaccacttcgcgtccagcaaccacgaccgggtcgagccccggcccacaggcctgttcttccgtctggggtcagtgcggcggacagaactggtctggccctacctgctgtgcttctggcagcacatgcgtctactctaacgactactatagccagtgcctgccgggtgctaacccgccaggcactaccactacctctcgccccgctaccactacaggctctagcccgggacctacccaaagccactacggccagtgcggaggcattggctacagcggccctaccgtctgcgcctccggaaccacctgccaagtcctgaacccgtactactcccagtgtctt BBa_K1321009_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z