BBa_K1328003 1 BBa_K1328003 Insulin (modified protease recognition sites) 2014-10-08T11:00:00Z 2015-05-08T01:09:54Z Assembled from 12 short synthesized DNA sequences. Encodes the human insulin gene (full length). Two 6 bp sequences were inserted into two separate sites within the insulin gene to allow enzymatic digestion by the protease furin. Originally, proinsulin is cleaved three times with three different enzymes, prohormone convertases (PC1 and PC2), and carboxypeptidase E before being secreted as mature insulin. Since PC1 and PC2 expression is tissue specific, we replaced their recognition sites with that of furin, which is universally expressed, thus allowing this insulin gene to be expressed and processed in any somatic cell type. false false _1703_ 0 15664 9 It's complicated false PC1 and PC2 protease recognition sites were replaced with that of furin, to allow insulin processing in somatic cells other than natural insulin-secreting cells. false Lingfeng Hou annotation2407295 1 Furin site range2407295 1 205 216 annotation2407294 1 Insulin CDS range2407294 1 43 384 annotation2407297 1 Regulator range2407297 1 1 42 annotation2407296 1 Furin site range2407296 1 310 321 BBa_K1328003_sequence 1 agccctccaggacaggctgcatcagaagaggccatcaagcagatggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccggaagcgtgaggcagaggacctgcaagtggggcaggtggagctgggcggggggcctggtgcaggcagcctgcaacccttggccctggaggggtccctgcaacgccggaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z