BBa_K1329000 1 BBa_K1329000 StrepDARPidin 2014-09-30T11:00:00Z 2015-05-08T01:09:54Z The sequence for streptavidin was found in the Streptomyces avidinii genome (http://blast.st-va.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_134951). The sequence was synthesized and optimized for E. Coli codon usage. The aminoacid sequence of DARPin Ec1 was found in the supplementary materials of the publication "DARPins Recognizing the Tuor-Associated Antigen EpCAM Selected by Phage and Ribosome Display and Engineered for Multivalency". The sequence was synthesized and optimized for E. Coli codon usage. StrepDARPidin is a fusion protein combining the monomeric streptavidin from Streptomyces avidinii and the DARPin (Designed Ankrin Repeat Protein) EC1 for targeting a tumor surface marker. Streptavidin monomers build up tetrameric constructs and have high and specific affinity to biotin or Strep-Tags. The DARPin EC1 was designed for an specific binding of EpCAM which is a surface marker of tumor cells derived from epithelial tissue. Our idea was to create a fusion protein which can be used for targeting appropiate cells with increased affinity by creating induced proximity using tetrameric structures. Additionally these can be used for linking biotinylated or Strep-tagged constructs at the same time. false false _1704_ 0 22000 9 In stock false We designed the construct with an N-terminal His-Tag for purification and Antibody targeting. GS-linkers were used to give the construct flexibility to provide steric tensions. false Daniela Geist BBa_K1329000_sequence 1 caccatcaccatcatcatatggatcttggcaagaaactcctcgaagcggctcgtgcaggtcaggacgacgaagtgcgtattctggtcgcgaacggggcggatgttaacgcttattttgggaccacgccactgcatcttgcagcagcgcatggtcgccttgagattgtggagttgctgaaaaatggcgcggatgttaatgcccaggatgtgtggggcatcaccccgctgcacctggcagcgtataacgggcatctggaaatcgtggaagtgttattaaaatatggcgctgatgtgaacgcgcatgatacccgcgggtggaccccgttacatctggcggcgatcaacggccatttggaaattgttgaggtattacttaaaaacgttggcgctgacgttaatgcgcaggatcgctctggcaagactccgtttgatttagcaatcgataatggcaacgaggacattgctgaagtgttgcaaaaagcggccaaactcaatgggggaagtagtggcggatctagcgaggctggcatcactggcacgtggtataaccaactgggttcgacgtttatcgttaccgcgggagctgacggcgctctcaccggtacatacgaaagtgcggttggaaatgcagagtcccgttacgtcttgaccggccgttacgattccgccccagcgacagatggctctggcacagccctgggctggacggtggcttggaagaataactaccggaacgcgcactctgctacgacatggtccggtcagtatgtcggcggggcagaagcccgtattaatacacaatggcttctgactagcgggaccaccgaggcgaacgcatggaaatcgactctcgtcggtcatgataccttcactaaagtaaaaccgagcgctgcaagctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z