BBa_K133036 1 RGD-His-St RGD-His affinity tag-Stop 2008-10-25T11:00:00Z 2015-05-08T01:09:55Z Part was constructed by primer annealing. This is His-tag with stop codon and RGD seguence. His-tag is used for detection of His-tagged proteins by anti-His antibodies. RGD is arginine-glycine-aspartic amino acid sequence, present on several extracellular matrix proteins. It is required for binding to integrins. false false _231_ 0 3350 9 It's complicated false Cloned into pSB1AK3 vector. false Jerneja Mori BBa_K133036_sequence 1 cgaggagaccaccaccaccaccaccactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z