BBa_K133044 1 BBa_K133044 TetR(RBS) 2008-10-25T11:00:00Z 2015-05-08T01:09:55Z We improved the part from registry (BBa_R0040) with adding an ribosomal binding site. TetR repressible promoter with ribosomal binding site. false false _231_ 0 3350 9 It's complicated false Cloned into pSB1AK3 vector. false Jerneja Mori BBa_K133044_sequence 1 tccctatcagtgatagagatactgagcacaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z