BBa_K133133 1 His-Stop His affinity tag-stop 2008-10-22T11:00:00Z 2015-05-08T01:09:57Z Part was constructed by primer annealing. This is His-tag with stop codon. His-tag is used for detection of His-tagged proteins by anti-His antibodies. Cloned into pSB1AK3 vector. false false _231_ 0 1883 9 It's complicated false false Katja Kolar BBa_K133133_sequence 1 caccaccaccaccaccactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z