BBa_K1332004 1 BBa_K1332004 The 5?? side of the intron(+exon fragment) from td gene of T4 phage 2014-09-25T11:00:00Z 2015-09-17T07:41:04Z Td gene of T4 phage This part and 3??? side of the intron (BBa_K1332005) makes mRNA annular. false false _1707_ 20591 21011 9 In stock false Nothing false Kenta Nomura BBa_K1332004_sequence 1 cagtagatgttttcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z