BBa_K1332006 1 BBa_K1332006 TTHA0715 with amino acid sequence cut by thrombin 2014-09-25T11:00:00Z 2015-09-17T07:54:03Z unknown TTHA0715 is a cold shock protein. It is cut by thrombin. false false _1707_ 20591 21011 9 Not in stock false A sequence coding an amino acid sequence cut by thrombin is added for cutting by a monomer unit. Stop codons are removed to translate consecutively. false Kenta Nomura BBa_K1332006_sequence 1 agatgcaaaagggtcgggtcaagtggttcaacgcggaaaagggctacggcttcattgagcgggaaggcgacacggacgtcttcgtccactacaccgccatcaacgccaaggggttccgcaccctcaacgagggggacatcgtcacctttgacgtggagccgggccggaacggcaagggcccccaggcggtcaacgtcacggtggtggagcccgcgcggcgcggtctggtgccacgcggtagtggtgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z